aboutsummaryrefslogtreecommitdiffstats
path: root/gcc-4.9/gcc/testsuite/go.test
diff options
context:
space:
mode:
authorBen Cheng <bccheng@google.com>2014-03-25 22:37:19 -0700
committerBen Cheng <bccheng@google.com>2014-03-25 22:37:19 -0700
commit1bc5aee63eb72b341f506ad058502cd0361f0d10 (patch)
treec607e8252f3405424ff15bc2d00aa38dadbb2518 /gcc-4.9/gcc/testsuite/go.test
parent283a0bf58fcf333c58a2a92c3ebbc41fb9eb1fdb (diff)
downloadtoolchain_gcc-1bc5aee63eb72b341f506ad058502cd0361f0d10.zip
toolchain_gcc-1bc5aee63eb72b341f506ad058502cd0361f0d10.tar.gz
toolchain_gcc-1bc5aee63eb72b341f506ad058502cd0361f0d10.tar.bz2
Initial checkin of GCC 4.9.0 from trunk (r208799).
Change-Id: I48a3c08bb98542aa215912a75f03c0890e497dba
Diffstat (limited to 'gcc-4.9/gcc/testsuite/go.test')
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/go-test.exp1167
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/235.go75
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/64bit.go728
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/README.gcc7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/alias.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/alias1.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/append.go247
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/args.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/assign.go56
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/assign1.go346
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/Makefile23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/parser.go280
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/peano.go121
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/stats.go52
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree.go100
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree2.go95
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go63
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go84
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fasta_test.go179
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fmt_test.go68
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gob_test.go93
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gzip_test.go63
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/http_test.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/json_test.go87
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go1819
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/mandel_test.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parser_test.go43
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parserdata_test.go245
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/regexp_test.go59
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go85
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/template_test.go76
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/go1/time_test.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go129
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c164
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go92
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c330
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go180
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go224
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.txt31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch.c134
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch.go122
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch.txt31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fasta-1000.out171
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fasta.c219
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fasta.go205
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fasta.txt171
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.go157
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide-parallel.txt27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.c228
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.go140
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/k-nucleotide.txt27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.c91
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.go95
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/mandelbrot.txtbin0 -> 5011 bytes
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.c626
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.go656
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/meteor-contest.txt24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/nbody.c170
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/nbody.go177
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/nbody.txt2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/pidigits.c123
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/pidigits.go135
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/pidigits.txt3
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.go124
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/regex-dna-parallel.txt13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/regex-dna.c154
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/regex-dna.go106
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/regex-dna.txt13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.c100
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.go105
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/reverse-complement.txt171
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/spectral-norm-parallel.go111
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.c82
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.go93
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/spectral-norm.txt1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/threadring.c103
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/threadring.go71
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/threadring.txt1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/timing.log1254
-rwxr-xr-xgcc-4.9/gcc/testsuite/go.test/test/bench/shootout/timing.sh219
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bigalg.go130
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bigmap.go139
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/blank.go189
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/blank1.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bom.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bombad.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bounds.go270
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bugs/bug395.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/bugs/placeholder2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/doubleselect.go86
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/fifo.go57
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/goroutines.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/nonblock.go282
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/perm.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/powser1.go711
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/powser2.go725
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select.go58
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select2.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select3.go224
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select4.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select5.go481
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select6.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/select7.go68
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/sendstmt.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/sieve1.go56
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/sieve2.go188
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chan/zerosize.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/chancap.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/char_lit.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/char_lit1.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/closedchan.go359
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/closure.go128
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmp.go429
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmp6.go75
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmplx.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmplxdivide.c83
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmplxdivide.go51
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/cmplxdivide1.go2407
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/complit.go120
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/complit1.go42
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/compos.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const.go127
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const1.go94
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const2.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const3.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const4.go82
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const5.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/const6.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convT2X.go195
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convert.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convert1.go99
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convert3.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convlit.go67
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/convlit1.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/copy.go351
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/crlf.go50
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ddd.go230
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ddd1.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ddd2.dir/ddd2.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ddd2.dir/ddd3.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ddd2.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/decl.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/declbad.go67
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/defer.go52
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/deferfin.go63
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/deferprint.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/deferprint.out2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/divide.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/divmod.go460
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/main.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z1.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z10.go6
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z11.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z12.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z13.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z14.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z15.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z16.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z17.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z18.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z19.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z2.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z20.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z3.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z4.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z5.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z6.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z7.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z8.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.dir/z9.go4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/dwarf.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/dwarf/linedirectives.go83
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/empty.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/env.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/eof.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/eof1.go12
-rwxr-xr-xgcc-4.9/gcc/testsuite/go.test/test/errchk147
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/escape.go224
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/escape2.go1359
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/escape3.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/escape4.go57
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/escape5.go151
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug000.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug002.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug003.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug004.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug005.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug006.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug007.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug008.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug009.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug010.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug011.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug012.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug013.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug014.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug015.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug016.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug017.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug020.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug021.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug022.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug023.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug024.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug026.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug027.go84
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug028.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug030.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug031.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug035.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug037.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug039.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug040.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug045.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug046.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug047.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug048.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug049.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug050.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug051.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug052.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug053.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug054.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug055.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug056.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug057.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug058.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug059.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug060.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug061.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug062.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug063.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug064.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug065.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug066.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug067.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug068.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug069.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug070.go40
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug071.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug072.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug073.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug074.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug075.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug076.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug077.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug078.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug080.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug081.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug082.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug083.dir/bug0.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug083.dir/bug1.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug083.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug084.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug085.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug086.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug087.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug088.dir/bug0.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug088.dir/bug1.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug088.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug089.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug090.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug091.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug092.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug093.go63
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug094.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug096.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug097.go53
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug098.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug099.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug101.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug102.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug103.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug104.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug106.dir/bug0.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug106.dir/bug1.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug106.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug107.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug108.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug109.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug110.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug111.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug112.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug113.go44
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug114.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug115.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug116.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug117.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug118.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug119.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug120.go60
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug121.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug122.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug123.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug126.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug127.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug128.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug129.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug130.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug131.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug132.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug133.dir/bug0.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug133.dir/bug1.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug133.dir/bug2.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug133.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug135.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug136.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug137.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug139.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug140.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug141.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug142.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug143.go44
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug144.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug145.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug146.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug147.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug148.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug149.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug150.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug151.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug1515.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug152.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug154.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug155.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug156.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug157.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug158.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug159.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug160.dir/x.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug160.dir/y.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug160.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug161.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug163.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug164.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug165.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug167.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug168.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug169.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug170.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug171.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug172.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug173.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug174.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug175.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug176.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug177.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug178.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug179.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug180.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug181.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug182.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug183.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug184.go49
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug185.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug186.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug187.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug188.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug189.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug190.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug191.dir/a.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug191.dir/b.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug191.dir/main.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug191.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug192.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug193.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug194.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug195.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug196.go50
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug197.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug198.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug199.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug200.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug201.go48
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug202.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug203.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug204.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug205.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug206.go48
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug206.out2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug207.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug208.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug209.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug211.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug212.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug213.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug214.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug215.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug216.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug217.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug218.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug219.go38
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug221.go42
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug222.dir/chanbug.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug222.dir/chanbug2.go6
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug222.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug223.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug224.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug225.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug227.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug228.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug229.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug230.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug231.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug232.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug233.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug234.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug235.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug236.go53
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug237.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug238.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug239.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug240.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug241.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug242.go133
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug243.go51
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug244.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug245.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug246.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug247.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug248.dir/bug0.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug248.dir/bug1.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug248.dir/bug2.go105
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug248.dir/bug3.go73
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug248.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug249.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug250.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug251.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug252.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug253.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug254.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug255.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug256.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug257.go20069
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug258.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug259.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug260.go65
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug261.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug262.go53
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug263.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug264.go44
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug265.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug266.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug267.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug269.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug271.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug272.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug273.go86
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug274.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug275.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug276.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug277.go72
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug278.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug279.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug280.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug281.go55
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug282.dir/p1.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug282.dir/p2.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug282.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug283.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug284.go191
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug285.go102
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug286.go90
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug287.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug288.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug289.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug290.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug291.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug292.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug293.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug294.go79
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug295.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug296.go88
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug297.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug298.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug299.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug300.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug301.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug302.dir/main.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug302.dir/p.go1011
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug302.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug303.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug304.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug305.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug306.dir/p1.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug306.dir/p2.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug306.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug307.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug308.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug309.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug311.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug312.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug313.dir/a.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug313.dir/b.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug313.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug314.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug315.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug316.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug317.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug318.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug319.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug320.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug321.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug322.dir/lib.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug322.dir/main.go40
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug322.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug323.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug324.dir/p.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug324.dir/prog.go53
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug324.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug325.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug326.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug327.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug328.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug328.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug329.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug330.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug331.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug332.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug333.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug334.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug335.dir/a.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug335.dir/b.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug335.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug336.go86
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug337.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug338.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug339.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug340.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug341.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug342.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug343.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug344.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug345.dir/io.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug345.dir/main.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug345.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug346.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug347.go49
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug348.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug349.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug350.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug351.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug352.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug353.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug354.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug355.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug356.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug357.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug358.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug361.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug362.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug363.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug364.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug365.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug366.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/p.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug367.dir/prog.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug367.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug368.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug369.dir/pkg.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug369.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug370.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug371.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug372.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug373.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug374.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug375.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug376.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/one.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug377.dir/two.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug377.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug378.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug379.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug380.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug381.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug382.dir/pkg.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug382.dir/prog.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug382.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug383.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug384.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug385_32.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug385_64.go223
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug386.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug387.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug388.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug389.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug390.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug391.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/one.go43
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/pkg2.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug392.dir/pkg3.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug392.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug393.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug394.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/one.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug396.dir/two.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug396.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug397.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug398.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug399.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug401.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug402.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug403.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug404.dir/one.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug404.dir/two.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug404.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug405.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug406.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug407.dir/one.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug407.dir/two.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug407.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug409.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug409.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug410.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug411.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug412.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug413.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug414.dir/p1.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug414.dir/prog.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug414.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug415.dir/p.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug415.dir/prog.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug415.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug416.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug417.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug418.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug419.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug420.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug421.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug422.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug423.go277
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug424.dir/lib.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug424.dir/main.go97
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug424.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug425.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug426.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug427.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug428.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug429.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug430.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug431.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug432.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug433.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug434.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug435.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug436.go32
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug437.dir/one.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug437.dir/two.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug437.dir/x.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug437.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug438.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug439.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug440_32.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug440_64.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug441.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug442.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug443.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug444.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug445.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug446.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug447.go105
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug448.dir/pkg1.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug448.dir/pkg2.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug448.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug449.go69
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug450.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug451.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug452.go38
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug453.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug454.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug455.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug456.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug457.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug458.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug459.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug460.dir/a.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug460.dir/b.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug460.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug461.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug462.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug463.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug464.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug465.dir/a.go76
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug465.dir/b.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug465.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug466.dir/a.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug466.dir/b.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug466.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug467.dir/p1.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug467.dir/p2.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug467.dir/p3.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug467.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug468.dir/p1.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug468.dir/p2.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug468.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug470.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug471.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug472.dir/p1.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug472.dir/p2.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug472.dir/z.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug472.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug473.go69
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug474.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug475.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug476.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug477.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug478.dir/a.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug478.dir/b.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug478.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug479.dir/a.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug479.dir/b.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug479.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug480.dir/a.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug480.dir/b.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug480.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug481.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/bug482.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue2615.go547
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3552.dir/one.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3552.dir/two.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3552.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3705.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3783.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3924.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue3925.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4066.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4085a.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4085b.go49
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4097.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4099.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4162.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4167.go50
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4232.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4251.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4252.dir/a.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4252.dir/main.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4252.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4264.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4283.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4313.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4316.go64
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4323.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.dir/p1.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.dir/p2.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.dir/q1.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.dir/q2.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.dir/z.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4326.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4348.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4353.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4359.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4370.dir/p1.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4370.dir/p2.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4370.dir/p3.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4370.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4396a.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4396b.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4399.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4405.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4429.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4448.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4452.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4458.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4463.go87
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4468.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4470.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4495.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4510.dir/f1.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4510.dir/f2.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4510.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4517a.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4517b.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4517c.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4517d.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4518.go67
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4529.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4545.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4562.go49
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4585.go151
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4590.dir/pkg1.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4590.dir/pkg2.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4590.dir/prog.go25
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4590.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4610.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4614.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4618.go41
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4620.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4654.go71
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4663.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4667.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4734.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4748.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4752.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4776.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4785.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4813.go52
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4847.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4879.dir/a.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4879.dir/b.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4879.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4909a.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4909b.go80
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4932.dir/foo.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4932.dir/state.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4932.dir/state2.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4932.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4964.dir/a.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4964.dir/b.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue4964.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5002.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5056.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5089.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5105.dir/a.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5105.dir/b.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5105.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5125.dir/bug.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5125.dir/main.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5125.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5162.go88
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5172.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5231.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5244.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5259.dir/bug.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5259.dir/main.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5259.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5260.dir/a.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5260.dir/b.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5260.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5291.dir/pkg1.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5291.dir/prog.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5291.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5358.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5470.dir/a.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5470.dir/b.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5470.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5493.go59
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5515.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5581.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5607.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5609.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5614.dir/rethinkgo.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5614.dir/x.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5614.dir/y.go5
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5614.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5698.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5704.go46
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5753.go29
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5755.dir/a.go60
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5755.dir/main.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5755.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5809.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5820.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5841.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5856.go38
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5910.dir/a.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5910.dir/main.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5910.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5957.dir/a.go3
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5957.dir/b.go2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5957.dir/c.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5957.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue5963.go50
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6004.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6036.go44
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6055.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6131.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6140.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6247.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6269.go39
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6298.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6399.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6513.dir/a.go7
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6513.dir/b.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6513.dir/main.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6513.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6789.dir/a.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6789.dir/b.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6789.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6899.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue6899.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/fixedbugs/issue887.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/float_lit.go203
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/floatcmp.go93
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/for.go58
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func.go90
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func1.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func2.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func3.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func4.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func5.go91
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func6.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func7.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/func8.go49
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/funcdup.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/funcdup2.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/gc.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/gc1.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/gc2.go44
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/golden.out24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/goprint.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/goprint.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/goto.go538
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/helloworld.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/helloworld.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/if.go93
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import1.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import2.dir/import2.go42
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import2.dir/import3.go52
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import2.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import4.dir/empty.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import4.dir/import4.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import4.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/import5.go55
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/index.go299
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/index0.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/index1.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/index2.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/indirect.go87
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/indirect1.go72
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/init.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/init1.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/initcomma.go81
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/initialize.go64
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/initializerr.go40
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/int_lit.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/intcvt.go181
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/bigdata.go74
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/convert.go146
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/convert1.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/convert2.go24
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/embed.go61
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/embed1.dir/embed0.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/embed1.dir/embed1.go43
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/embed1.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/embed2.go70
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/explicit.go101
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/fail.go53
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/fake.go97
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/noeq.go40
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/pointer.go38
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/private.dir/private1.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/private.dir/prog.go33
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/private.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/receiver.go121
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/receiver1.go59
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/recursive.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/recursive1.dir/recursive1.go15
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/recursive1.dir/recursive2.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/recursive1.go9
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/returntype.go38
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/interface/struct.go156
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/iota.go122
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/array.go138
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/chan.go331
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/chan1.go55
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/complit.go172
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/convert.go432
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx0.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx0.out4
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx1.go99
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx2.go122
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx3.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx4.go61
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/cplx5.go72
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/divconst.go634
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/divmod.go249
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/embed.go319
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/for.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/interbasic.go184
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/interfun.go59
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/intervar.go69
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/label.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/litfun.go23
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/mfunc.go22
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/modconst.go634
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/ptrfun.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/ptrvar.go54
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/range.go121
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/rob1.go72
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/rob2.go280
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/robfor.go58
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/robfunc.go96
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/shift.go121
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simparray.go50
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simpbool.go107
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simpconv.go30
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simpfun.go26
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simpswitch.go28
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/simpvar.go27
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/slicearray.go212
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/sliceslice.go205
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/string.go114
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/string.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/ken/strvar.go79
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/label.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/label1.go88
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/linkx.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/literal.go229
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/mallocfin.go77
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/map.go684
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/map1.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/mapnan.go56
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method.go307
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method1.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method2.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method3.go35
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method4.dir/method4a.go37
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method4.dir/prog.go104
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method4.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/method5.go297
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/named.go281
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/named1.go62
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nil.go180
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nilcheck.go184
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nilptr.go182
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nilptr2.go128
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nilptr3.go191
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/nul1.go56
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/parentype.go19
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/peano.go125
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/printbig.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/printbig.out2
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/range.go310
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/recover.go505
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/recover1.go141
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/recover2.go85
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/recover3.go83
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rename.go103
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rename1.go60
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/reorder.go114
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/reorder2.go174
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/return.go2821
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rotate.go166
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rotate0.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rotate1.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rotate2.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rotate3.go12
-rwxr-xr-xgcc-4.9/gcc/testsuite/go.test/test/run138
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/run.go916
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/rune.go47
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/runtime.go21
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/safe/main.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/safe/nousesafe.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/safe/pkg.go16
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/safe/usesafe.go8
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/shift1.go241
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/shift2.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/sieve.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/sigchld.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/sigchld.out1
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/simassign.go79
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/sinit.go271
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/sizeof.go158
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/slice3.go156
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/slice3err.go121
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/solitaire.go118
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/stack.go100
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/stress/maps.go111
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/stress/parsego.go220
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/stress/runstress.go169
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/string_lit.go150
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/stringrange.go71
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/struct0.go34
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/switch.go403
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/switch3.go72
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/switch4.go36
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/chan.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/chan1.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/composite.go11
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/else.go12
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/forvar.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/if.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/import.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/interface.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi1.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi2.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi3.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi4.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi5.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi6.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/semi7.go14
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/topexpr.go20
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/typesw.go13
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/vareq.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/syntax/vareq1.go10
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/testlib170
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/torture.go339
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/turing.go59
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/typecheck.go18
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/typeswitch.go116
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/typeswitch1.go85
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/typeswitch2.go47
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/typeswitch3.go43
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/undef.go45
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/utf.go66
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/varerr.go17
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/varinit.go31
-rw-r--r--gcc-4.9/gcc/testsuite/go.test/test/zerodivide.go243
1102 files changed, 87953 insertions, 0 deletions
diff --git a/gcc-4.9/gcc/testsuite/go.test/go-test.exp b/gcc-4.9/gcc/testsuite/go.test/go-test.exp
new file mode 100644
index 0000000..1bbbd87
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/go-test.exp
@@ -0,0 +1,1167 @@
+# Copyright (C) 2009-2014 Free Software Foundation, Inc.
+# Written by Ian Lance Taylor <iant@google.com>.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 3 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with GCC; see the file COPYING3. If not see
+# <http://www.gnu.org/licenses/>.
+
+
+# Test using the testsuite for the gc Go compiler. In these tests the
+# first line is a shell script to run. That line expects the
+# following environment variables to be set:
+# A The file extension of the object file and the name of the executable
+# G The name of the compiler
+# L The name of the linker
+# F The basename of the test
+# D The directory of the test.
+#
+# Typical command lines:
+# // compile
+# // run
+# // $G $D/$F.go && $L $F.$A && ./$A.out
+# // $G $D/$F.go && $L $F.$A || echo BUG: known to fail incorrectly
+# // $G $D/$F.go && echo BUG: compilation succeeds incorrectly
+# // $G $D/$F.go || echo BUG: compilation should succeed
+
+load_lib go-dg.exp
+load_lib go-torture.exp
+load_lib target-supports.exp
+
+# Compare two files
+proc filecmp { file1 file2 testname } {
+ set f1 [open $file1 r]
+ set f2 [open $file2 r]
+ set ok 1
+ while { [gets $f1 line1] >= 0 } {
+ if { [gets $f2 line2] < 0 } {
+ verbose -log "output mismatch: $file2 shorter than $file1"
+ set ok 0
+ break
+ }
+ if { $line1 != $line2 } {
+ verbose -log "output mismatch comparing $file1 and $file2"
+ verbose -log "expected \"$line1\""
+ verbose -log "got \"$line2\""
+ set ok 0
+ break
+ }
+ }
+ if { [gets $f2 line2] >= 0 } {
+ verbose -log "output mismatch: $file1 shorter than $file2"
+ set ok 0
+ }
+ close $f1
+ close $f2
+ if { ! $ok } {
+ fail $testname
+ } else {
+ pass $testname
+ }
+}
+
+# Implement errchk
+proc errchk { test opts } {
+ global dg-do-what-default
+ global DEFAULT_GOCFLAGS
+ global runtests
+
+ set saved-dg-do-what-default ${dg-do-what-default}
+ set dg-do-what-default compile
+ set filename [file tail $test]
+ if { "$filename" == "$test" } {
+ set filename "errchk-$filename"
+ }
+ set fdin [open $test r]
+ fconfigure $fdin -encoding binary
+ set fdout [open $filename w]
+ fconfigure $fdout -encoding binary
+ while { [gets $fdin copy_line] >= 0 } {
+ if [string match "*////*" $copy_line] {
+ puts $fdout $copy_line
+ continue
+ }
+
+ # Combine quoted strings in comments, so that
+ # // ERROR "first error" "second error"
+ # turns into
+ # // ERROR "first error|second error"
+ # This format is used by the master testsuite to recognize
+ # multiple errors on a single line. We don't require that all
+ # the errors be present, but we do want to accept any of them.
+ set changed ""
+ while { $changed != $copy_line } {
+ set changed $copy_line
+ regsub "\(// \[^\"\]*\"\[^\"\]*\)\" \"" $copy_line "\\1|" out_line
+ set copy_line $out_line
+ }
+
+ regsub "// \(GCCGO_\)?ERROR \"\(\[^\"\]*\)\".*$" $copy_line "// \{ dg-error \"\\2\" \}" out_line
+ if [string match "*dg-error*\\\[*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\\\\\\\[" $out_line "\\\\\\\\\\\[" out_line
+ }
+ if [string match "*dg-error*\\\]*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\\\\\\\]" $out_line "\\\\\\\\\\\]" out_line
+ }
+ if [string match "*dg-error*.\**" $out_line] {
+ # I worked out the right number of backslashes by
+ # experimentation, not analysis.
+ regsub -all "\\.\\*" $out_line "\\\\\[ -~\\\\\]*" out_line
+ }
+ if [string match "*dg-error*\\\[?\\\]*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -all "\\\[\(.\)\\\]" $out_line "\\\\\[\\1\\\\\]" out_line
+ }
+ if [string match "*dg-error*\{*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\(\[^\\\\]\)\{" $out_line "\\1\\\\\[\\\{\\\\\]" out_line
+ }
+ if [string match "*dg-error*\}*\}" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\(\[^\\\\]\)\}\(.\)" $out_line "\\1\\\\\[\\\}\\\\\]\\2" out_line
+ }
+ if [string match "*dg-error*\(*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\\\\\\\(" $out_line "\\\\\[\\\(\\\\\]" out_line
+ }
+ if [string match "*dg-error*\)*\}" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index -all "\\\\\\\)\(.\)" $out_line "\\\\\[\\\)\\\\\]\\1" out_line
+ }
+ # Special case for bug332, in which the error message wants to
+ # match the file name, which is not what dg-error expects.
+ if [string match "*dg-error*bug332*" $out_line] {
+ set index [string first "dg-error" $out_line]
+ regsub -start $index "bug332" $out_line "undefined type" out_line
+ }
+ puts $fdout $out_line
+ }
+ close $fdin
+ close $fdout
+
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ go-dg-runtest $filename "-fno-show-column $DEFAULT_GOCFLAGS $opts"
+ set runtests $hold_runtests
+
+ file delete $filename
+ set dg-do-what-default ${saved-dg-do-what-default}
+}
+
+# This is an execution test which should fail.
+proc go-execute-xfail { test } {
+ global DEFAULT_GOCFLAGS
+ global runtests
+
+ set filename [file tail $test]
+ set fdin [open $test r]
+ set fdout [open $filename w]
+ puts $fdout "// { dg-do run { xfail *-*-* } }"
+ while { [gets $fdin copy_line] >= 0 } {
+ puts $fdout $copy_line
+ }
+ close $fdin
+ close $fdout
+
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ go-dg-runtest $filename "-w $DEFAULT_GOCFLAGS"
+ set runtests $hold_runtests
+
+ file delete $filename
+}
+
+# N.B. Keep in sync with libgo/configure.ac.
+proc go-set-goarch { } {
+ global target_triplet
+
+ switch -glob $target_triplet {
+ "aarch64*-*-*" {
+ set goarch "arm64"
+ }
+ "alpha*-*-*" {
+ set goarch "alpha"
+ }
+ "arm*-*-*" -
+ "ep9312*-*-*" -
+ "strongarm*-*-*" -
+ "xscale-*-*" {
+ set goarch "arm"
+ }
+ "i?86-*-*" -
+ "x86_64-*-*" {
+ if [check_effective_target_ia32] {
+ set goarch "386"
+ } else {
+ set goarch "amd64"
+ }
+ }
+ "mips*-*-*" {
+ if [check_no_compiler_messages mipso32 assembly {
+ #if _MIPS_SIM != _ABIO32
+ #error FOO
+ #endif
+ }] {
+ set goarch "mipso32"
+ } elseif [check_no_compiler_messages mipsn32 assembly {
+ #if _MIPS_SIM != _ABIN32
+ #error FOO
+ #endif
+ }] {
+ set goarch "mipsn32"
+ } elseif [check_no_compiler_messages mipsn64 assembly {
+ #if _MIPS_SIM != _ABI64
+ #error FOO
+ #endif
+ }] {
+ set goarch "mipsn64"
+ } elseif [check_no_compiler_messages mipso64 assembly {
+ #if _MIPS_SIM != _ABIO64
+ #error FOO
+ #endif
+ }] {
+ set goarch "mipso64"
+ } else {
+ perror "$target_triplet: unrecognized MIPS ABI"
+ return ""
+ }
+ }
+ "powerpc*-*-*" {
+ if [check_effective_target_ilp32] {
+ set goarch "ppc"
+ } else {
+ set goarch "ppc64"
+ }
+ }
+ "sparc*-*-*" {
+ if [check_effective_target_ilp32] {
+ set goarch "sparc"
+ } else {
+ set goarch "sparc64"
+ }
+ }
+ default {
+ perror "$target_triplet: unhandled architecture"
+ return ""
+ }
+ }
+ verbose -log "Setting GOARCH=$goarch" 1
+ setenv GOARCH $goarch
+}
+
+# Take a list of files and return a lists of lists, where each list is
+# the set of files in the same package.
+proc go-find-packages { test name files } {
+ set packages [list]
+ foreach f $files {
+ set fd [open $f r]
+ while 1 {
+ if { [gets $fd line] < 0 } {
+ close $fd
+ clone_output "$test: could not read $f"
+ unresolved $name
+ return [list]
+ }
+
+ if { [regexp "^package (\\w+)" $line match package] } {
+ set len [llength $packages]
+ for { set i 0 } { $i < $len } { incr i } {
+ set p [lindex $packages $i]
+ if { [lindex $p 0] == $package } {
+ lappend p $f
+ lset packages $i $p
+ break
+ }
+ }
+ if { $i >= $len } {
+ lappend packages [list $package $f]
+ }
+
+ close $fd
+ break
+ }
+ }
+ }
+ return $packages
+}
+
+proc go-gc-tests { } {
+ global srcdir subdir
+ global runtests
+ global GCC_UNDER_TEST
+ global TOOL_OPTIONS
+ global TORTURE_OPTIONS
+ global dg-do-what-default
+ global go_compile_args
+ global go_execute_args
+ global target_triplet
+
+ # If a testcase doesn't have special options, use these.
+ global DEFAULT_GOCFLAGS
+ if ![info exists DEFAULT_GOCFLAGS] {
+ set DEFAULT_GOCFLAGS " -pedantic-errors"
+ }
+
+ set options ""
+ lappend options "additional_flags=$DEFAULT_GOCFLAGS"
+
+ # Set GOARCH for tests that need it.
+ go-set-goarch
+
+ # Running all the torture options takes too long and, since the
+ # frontend ignores the standard options, it doesn't significantly
+ # improve testing.
+ set saved_torture_options $TORTURE_OPTIONS
+ set TORTURE_OPTIONS [list { -O2 -g }]
+
+ set saved-dg-do-what-default ${dg-do-what-default}
+
+ set testdir [pwd]
+
+ set tests [lsort [find $srcdir/$subdir *.go]]
+ foreach test $tests {
+ if ![runtest_file_p $runtests $test] {
+ continue
+ }
+
+ # Skip the files in bench; they are not tests.
+ if [string match "*go.test/test/bench/*" $test] {
+ continue
+ }
+
+ # Skip the files in stress; they are not tests.
+ if [string match "*go.test/test/stress/*" $test] {
+ continue
+ }
+
+ # Skip the files in safe; gccgo does not support safe mode.
+ if [string match "*go.test/test/safe/*" $test] {
+ continue
+ }
+
+ # Skip files in sub-subdirectories: they are components of
+ # other tests.
+ if [string match "*go.test/test/*/*/*" $test] {
+ continue
+ }
+
+ # Skip files in *.dir subdirectories: they are components of
+ # other tests.
+ if [string match "*go.test/test/*.dir/*" $test] {
+ continue
+ }
+
+ set name [dg-trim-dirname $srcdir $test]
+
+ # Skip certain tests if target is RTEMS OS.
+ if [istarget "*-*-rtems*"] {
+ if { [string match "*go.test/test/args.go" $test] \
+ || [string match "*go.test/test/env.go" $test] } {
+ untested "$name: uses the command-line or environment variables"
+ continue
+ }
+
+ if { [string match "*go.test/test/stack.go" $test] \
+ || [string match "*go.test/test/peano.go" $test] \
+ || [string match "*go.test/test/chan/goroutines.go" $test] } {
+ untested "$name: has very high memory requirement"
+ continue
+ }
+ }
+
+ # Handle certain tests in a target-dependant way.
+ if { [istarget "alpha*-*-*"] || [istarget "sparc*-*-solaris*"] || [istarget "powerpc*-*-*"] } {
+ if { [string match "*go.test/test/nilptr.go" $test] } {
+ untested $test
+ continue
+ }
+ }
+
+ if { [file tail $test] == "init1.go" } {
+ # This tests whether GC runs during init, which for gccgo
+ # it currently does not.
+ untested $name
+ continue
+ }
+
+ if { [file tail $test] == "closure.go" } {
+ # This tests whether function closures do any memory
+ # allocation, which for gccgo they currently do.
+ untested $name
+ continue
+ }
+
+ if { ( [file tail $test] == "select2.go" \
+ || [file tail $test] == "stack.go" \
+ || [file tail $test] == "peano.go" ) \
+ && ! [check_effective_target_split_stack] } {
+ # These tests fails on targets without split stack.
+ untested $name
+ continue
+ }
+
+ if [string match "*go.test/test/rotate\[0123\].go" $test] {
+ # These tests produces a temporary file that takes too long
+ # to compile--5 minutes on my laptop without optimization.
+ # When compiling without optimization it tests nothing
+ # useful, since the point of the test is to see whether
+ # the compiler generates rotate instructions.
+ untested $name
+ continue
+ }
+
+ if { [file tail $test] == "bug347.go" \
+ || [file tail $test] == "bug348.go" } {
+ # These tests don't work if the functions are inlined.
+ set TORTURE_OPTIONS [list { -O0 -g }]
+ }
+
+ set fd [open $test r]
+
+ set lines_ok 1
+
+ while 1 {
+ if { [gets $fd test_line] < 0 } {
+ close $fd
+ clone_output "$test: could not read first line"
+ unresolved $name
+ set lines_ok 0
+ break
+ }
+
+ if { [ string match "*nacl*exit 0*" $test_line ] \
+ || [ string match "*exit 0*nacl*" $test_line ] \
+ || [ string match "*Android*exit 0*" $test_line ] \
+ || [ string match "*exit 0*Android*" $test_line ] \
+ || [ string match "*\"\$GOOS\" == windows*" $test_line ] } {
+ continue
+ }
+
+ if { [ string match "// +build *" $test_line ] } {
+ if { [ string match "*[getenv GOARCH]*" $test_line ] } {
+ continue
+ }
+ if { [ string match "*linux*" $test_line ] } {
+ continue
+ }
+ if { [ string match "*!windows*" $test_line ] } {
+ continue
+ }
+ close $fd
+ unsupported $name
+ set lines_ok 0
+ }
+
+ break
+ }
+
+ if { $lines_ok == 0 } {
+ continue
+ }
+
+ set lineno 1
+ set test_line1 $test_line
+
+ while { [eval "string match \"//*&&\" \${test_line$lineno}"] } {
+ set lineno [expr $lineno + 1]
+ if { [eval "gets \$fd test_line$lineno"] < 0 } {
+ close $fd
+ clone_output "$test: could not read line $lineno"
+ unresolved $name
+ set lines_ok 0
+ break
+ }
+ }
+ if { $lines_ok == 0 } {
+ continue
+ }
+
+ close $fd
+
+ set go_compile_args ""
+ set go_execute_args ""
+ if { [regexp "// run (\[^|&>2\].*)\$" $test_line match progargs] \
+ && ! [string match "*.go*" "$progargs"] } {
+ set go_execute_args $progargs
+ verbose -log "$test: go_execute_args is $go_execute_args"
+ set index [string last " $progargs" $test_line]
+ set test_line [string replace $test_line $index end]
+ } elseif { [string match "*go.test/test/chan/goroutines.go" $test] \
+ && [getenv GCCGO_RUN_ALL_TESTS] == "" } {
+ # goroutines.go spawns by default 10000 threads, which is too much
+ # for many OSes.
+ if { [getenv GCC_TEST_RUN_EXPENSIVE] == "" } {
+ set go_execute_args 64
+ } elseif { ![is_remote host] && ![is_remote target] } {
+ # When using low ulimit -u limit, use maximum of
+ # a quarter of that limit and 10000 even when running expensive
+ # tests, otherwise parallel tests might fail after fork failures.
+ set nproc [lindex [remote_exec host {sh -c ulimit\ -u}] 1]
+ if { [string is integer -strict $nproc] } {
+ set nproc [expr $nproc / 4]
+ if { $nproc > 10000 } { set nproc 10000 }
+ if { $nproc < 16 } { set nproc 16 }
+ set go_execute_args $nproc
+ }
+ }
+ if { "$go_execute_args" != "" } {
+ verbose -log "$test: go_execute_args is $go_execute_args"
+ }
+ }
+
+ if { $test_line == "// compile"
+ || $test_line == "// echo bug395 is broken # takes 90+ seconds to break" } {
+ # This is a vanilla compile test.
+ set dg-do-what-default "assemble"
+ go-dg-runtest $test "-w $DEFAULT_GOCFLAGS"
+ } elseif { $test_line == "// run"
+ || $test_line == "// \$G \$F.go && \$L \$F.\$A && ./\$A.out" } {
+ # This is a vanilla execution test.
+ go-torture-execute $test
+ file delete core [glob -nocomplain core.*]
+ } elseif { $test_line == "// build" } {
+ # This is a vanilla compile and link test.
+ set dg-do-what-default "link"
+ go-dg-runtest $test "-w $DEFAULT_GOCFLAGS"
+ } elseif { [string match "// runoutput*" $test_line] \
+ || ($test_line == "// \$G \$D/\$F.go && \$L \$F.\$A &&"
+ && $test_line2 == "// ./\$A.out >tmp.go && \$G tmp.go && \$L -o \$A.out1 tmp.\$A && ./\$A.out1") } {
+ # Run the test to get a .go program to run.
+ set go_execute_args ""
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set files [list]
+ if { [string match "// runoutput*" $test_line] } {
+ set args ""
+ regsub "// runoutput\(.*\)" $test_line "\\1" args
+ foreach f $args {
+ lappend files "[file dirname $test]/$f"
+ }
+ }
+ set dg-do-what-default "link"
+ dg-test -keep-output $test "-O" "$files -w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set base "[file rootname [file tail $test]]"
+ if [isnative] {
+ if { [catch "exec $output_file >$base-out.go"] != 0 } {
+ fail "$name execution"
+ } else {
+ pass "$name execution"
+ file delete $base-out.x
+ # Disable optimizations as some of these tests
+ # take a long time to compile.
+ set TORTURE_OPTIONS [list { -O0 -g -fno-var-tracking-assignments }]
+ go-torture-execute "./$base-out.go"
+ }
+ file delete $base-out.go
+ }
+ file delete $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// cmpout" \
+ || $test_line == "// (\$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out 2>&1 | cmp - \$D/\$F.out)" } {
+ # This is an execution test for which we need to check the
+ # program output.
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "link"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set base "[file rootname [file tail $test]]"
+ if [isnative] {
+ verbose -log "$output_file >$base.p 2>&1"
+ if { [catch "exec $output_file 2>$base.p" catcherr] != 0 } {
+ verbose -log $catcherr
+ fail "$name execution"
+ untested "$name compare"
+ } else {
+ pass "$name execution"
+ regsub "\\.go$" $test ".out" expect
+ filecmp $expect $base.p "$name compare"
+ }
+ file delete $base.p
+ } else {
+ untested "$name execution"
+ untested "$name compare"
+ }
+ set runtests $hold_runtests
+ } elseif { [string match "// \$G \$D/\$F.go && \$L \$F.\$A && ! ./\$A.out || echo BUG: *" \
+ $test_line] } {
+ go-execute-xfail $test
+ } elseif { $test_line == "// errorcheck" } {
+ errchk $test ""
+ } elseif { $test_line == "// errorcheckdir" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dir "[file rootname $test].dir"
+ set files [lsort [glob "$dir/*.go"]]
+ set packages [go-find-packages $test $name $files]
+ if { [llength $packages] > 0 } {
+ set dg-do-what-default "assemble"
+ set del [list]
+ set last [lindex $packages end]
+ set packages [lreplace $packages end end]
+ foreach p $packages {
+ dg-test -keep-output [lrange $p 1 end] "-O" "-w $DEFAULT_GOCFLAGS"
+ lappend del "[file rootname [file tail [lindex $p 1]]].o"
+ }
+ errchk [lindex $last 1] "[lrange $last 2 end]"
+ foreach f $del {
+ file delete $f
+ }
+ }
+ set runtests $hold_runtests
+ } elseif { [string match "// errorcheckoutput*" $test_line] } {
+ # Run the test to get a .go program to error check.
+ set go_execute_args ""
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set files [list]
+ regsub "// errorcheckoutput\(.*\)" $test_line "\\1" args
+ foreach f $args {
+ lappend files "[file dirname $test]/$f"
+ }
+ set dg-do-what-default "link"
+ dg-test -keep-output $test "-O" "$files -w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set base "[file rootname [file tail $test]]"
+ if [isnative] {
+ if { [catch "exec $output_file >$base-out.go"] != 0 } {
+ fail "$name execution"
+ } else {
+ pass "$name execution"
+ errchk "$base-out.go" ""
+ }
+ file delete $base-out.go
+ }
+ file delete $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// compiledir" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ set dir "[file rootname $test].dir"
+ set del {}
+ foreach f [lsort [glob "$dir/*.go"]] {
+ dg-test -keep-output $f "-O" "-w $DEFAULT_GOCFLAGS"
+ lappend del "[file rootname [file tail $f]].o"
+ }
+ foreach f $del {
+ file delete $f
+ }
+ set runtests $hold_runtests
+ } elseif { $test_line == "// rundir" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dir "[file rootname $test].dir"
+ set files [lsort [glob "$dir/*.go"]]
+ set packages [go-find-packages $test $name $files]
+ if { [llength $packages] > 0 } {
+ set dg-do-what-default "assemble"
+ set del [list]
+ set last [lindex $packages end]
+ set packages [lreplace $packages end end]
+ foreach p $packages {
+ dg-test -keep-output [lrange $p 1 end] "-O" "-w $DEFAULT_GOCFLAGS"
+ lappend del "[file rootname [file tail [lindex $p 1]]].o"
+ }
+ set dg-do-what-default "link"
+ set go_compile_args $del
+ go-torture-execute [lrange $last 1 end]
+ foreach f $del {
+ file delete $f
+ }
+ }
+ set runtests $hold_runtests
+ } elseif { $test_line == "// rundircmpout" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dir "[file rootname $test].dir"
+ set files [lsort [glob "$dir/*.go"]]
+ set packages [go-find-packages $test $name $files]
+ if { [llength $packages] > 0 } {
+ set dg-do-what-default "assemble"
+ set del [list]
+ set last [lindex $packages end]
+ set packages [lreplace $packages end end]
+ foreach p $packages {
+ dg-test -keep-output [lrange $p 1 end] "-O" "-w $DEFAULT_GOCFLAGS"
+ lappend del "[file rootname [file tail [lindex $p 1]]].o"
+ }
+ set dg-do-what-default "link"
+ dg-test -keep-output [lrange $last 1 end] "$del -O" "-w $DEFAULT_GOCFLAGS"
+ set base "[file rootname [file tail [lindex $last 1]]]"
+ set output_file "./$base.exe"
+ lappend del $output_file
+ if [isnative] {
+ verbose -log "$output_file >$base.p 2>&1"
+ if { [catch "exec $output_file 2>$base.p" catcherr] != 0 } {
+ verbose -log $catcherr
+ fail "$name execution"
+ untested "$name compare"
+ } else {
+ pass "$name execution"
+ regsub "\\.go$" "$test" ".out" expect
+ filecmp $expect $base.p "$name compare"
+ }
+ lappend del $base.p
+ }
+ foreach f $del {
+ file delete $f
+ }
+ }
+ set runtests $hold_runtests
+ } elseif { "$test_line" == ""
+ || [string match "// true*" $test_line]
+ || [string match "// skip*" $test_line] } {
+ # Not a real test, just ignore.
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/bug0.go && errchk \$G \$D/\$F.dir/bug1.go" \
+ $test_line] \
+ || [string match \
+ "// \$G \$D/\$F.dir/io.go && errchk \$G -e \$D/\$F.dir/main.go" \
+ $test_line] } {
+ if { [string match \
+ "// \$G \$D/\$F.dir/bug0.go && errchk \$G \$D/\$F.dir/bug1.go" \
+ $test_line] } {
+ set name1 "bug0.go"
+ set name2 "bug1.go"
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/io.go && errchk \$G -e \$D/\$F.dir/main.go" \
+ $test_line] } {
+ set name1 "io.go"
+ set name2 "main.go"
+ }
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/$name1" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ regsub "\\.go$" $test ".dir/$name2" file2
+ errchk $file2 ""
+ file delete "[file rootname [file tail $file1]].o"
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/\${F}1.go && errchk \$G \$D/\$F.go" \
+ $test_line ] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test "1.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ errchk $test ""
+ file delete "[file rootname [file tail $file1]].o"
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/bug0.go && \$G \$D/\$F.dir/bug1.go && errchk \$G \$D/\$F.dir/bug2.go" \
+ $test_line] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/bug0.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ regsub "\\.go$" $test ".dir/bug1.go" file2
+ dg-test -keep-output $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ regsub "\\.go$" $test ".dir/bug2.go" file3
+ errchk $file3 ""
+ file delete "[file rootname [file tail $file1]].o"
+ file delete "[file rootname [file tail $file2]].o"
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/bug160.dir/x.go && \$G \$D/bug160.dir/y.go && \$L y.\$A && ./\$A.out" \
+ $test_line] \
+ || [string match \
+ "// \$G \$D/\$F.dir/p.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out" \
+ $test_line] \
+ || $test_line == "// \$G \$D/\$F.dir/p1.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out" \
+ || $test_line == "// \$G \$D/\$F.dir/lib.go && \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out" \
+ || $test_line == "// \$G \$D/method4a.go && \$G \$D/\$F.go && \$L \$F.\$A && ./$\A.out" } {
+ if { [string match \
+ "// \$G \$D/bug160.dir/x.go && \$G \$D/bug160.dir/y.go && \$L y.\$A && ./\$A.out" \
+ $test_line] } {
+ set name1 "x.go"
+ set name2 "y.go"
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/p.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out" \
+ $test_line] } {
+ set name1 "p.go"
+ set name2 "main.go"
+ } elseif { $test_line == "// \$G \$D/\$F.dir/p1.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out" } {
+ set name1 "p1.go"
+ set name2 "main.go"
+ } elseif { $test_line == "// \$G \$D/\$F.dir/lib.go && \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out" } {
+ set name1 "lib.go"
+ set name2 ""
+ } elseif { $test_line == "// \$G \$D/method4a.go && \$G \$D/\$F.go && \$L \$F.\$A && ./$\A.out" } {
+ set name1 "method4a.go"
+ set name2 ""
+ }
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/$name1" file1
+ if { $name1 == "method4a.go" } {
+ set file1 "[file dirname $test]/method4a.go"
+ }
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ regsub "\\.go$" $test ".dir/$name2" file2
+ if { $name2 == "" } {
+ set file2 $test
+ }
+ dg-test -keep-output $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $file2]].o"
+ set dg-do-what-default "link"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile1 $ofile2" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ verbose -log $comp_output
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ file delete $ofile1 $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/\$F.dir/one.go && \$G \$D/\$F.dir/two.go && \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/one.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ regsub "\\.go$" $test ".dir/two.go" file2
+ dg-test -keep-output $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $file2]].o"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile3 "[file rootname [file tail $test]].o"
+ set dg-do-what-default "link"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile1 $ofile2 $ofile3" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ verbose -log $comp_output
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ file delete $ofile1 $ofile2 $ofile3 $output_file
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/embed0.go && \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out" \
+ $test_line ] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "/\[^/\]*$" $test "/embed0.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $test]].o"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile1 $ofile2" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete $ofile1 $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/lib.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out || echo BUG*" \
+ $test_line ] || \
+ [string match \
+ "// \$G \$D/\$F.dir/p.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out || echo BUG*" \
+ $test_line ] } {
+ if { [string match \
+ "// \$G \$D/\$F.dir/lib.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out || echo BUG*" \
+ $test_line ] } {
+ set name1 "lib.go"
+ set name2 "main.go"
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/p.go && \$G \$D/\$F.dir/main.go && \$L main.\$A && ./\$A.out || echo BUG*" \
+ $test_line ] } {
+ set name1 "p.go"
+ set name2 "main.go"
+ }
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/$name1" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ regsub "\\.go$" $test ".dir/$name2" file2
+ dg-test -keep-output $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $file2]].o"
+ set dg-do-what-default "link"
+ set output_file "./[file rootname [file tail $file2]].exe"
+ set comp_output [go_target_compile "$ofile1 $ofile2" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete $ofile1 $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/\$F.dir/bug0.go &&" \
+ && $test_line2 == "// \$G \$D/\$F.dir/bug1.go &&" \
+ && $test_line3 == "// \$G \$D/\$F.dir/bug2.go &&" \
+ && $test_line4 == "// errchk \$G -e \$D/\$F.dir/bug3.go &&" \
+ && $test_line5 == "// \$L bug2.\$A &&" \
+ && [string match "// ./\$A.out || echo BUG*" $test_line6] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/bug0.go" file0
+ dg-test -keep-output $file0 "-O -fgo-prefix=bug0" "-w $DEFAULT_GOCFLAGS"
+ set ofile0 "[file rootname [file tail $file0]].o"
+ regsub "\\.go$" $test ".dir/bug1.go" file1
+ dg-test -keep-output $file1 "-O -fgo-prefix=bug1" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ regsub "\\.go$" $test ".dir/bug2.go" file2
+ dg-test -keep-output $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $file2]].o"
+ regsub "\\.go$" $test ".dir/bug3.go" file3
+ errchk $file3 ""
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile0 $ofile1 $ofile2" \
+ $output_file "executable" "$options"]
+ set comp-output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete $ofile0 $ofile1 $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/import2.go && \$G \$D/\$F\.go" \
+ || $test_line == "// \$G \$D/recursive1.go && \$G \$D/\$F.go" } {
+ if { $test_line == "// \$G \$D/import2.go && \$G \$D/\$F\.go" } {
+ set name1 "import2.go"
+ } elseif { $test_line == "// \$G \$D/recursive1.go && \$G \$D/\$F.go" } {
+ set name1 "recursive1.go"
+ }
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "/\[^/\]*$" $test "/${name1}" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ dg-test $test "-O" "-w $DEFAULT_GOCFLAGS"
+ file delete $ofile1
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/ddd2.go && \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "/\[^/\]*$" $test "/ddd2.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile2 "[file rootname [file tail $test]].o"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile1 $ofile2" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete $ofile1 $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// run cmplxdivide1.go" } {
+ regsub "/\[^/\]*$" $test "/cmplxdivide1.go" test2
+ set output_file "./[file rootname [file tail $test]].o"
+ set comp_output [go_target_compile "$test $test2" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete $output_file
+ } elseif { $test_line == "// \$G \$D/\$F.go && \$L \$F.\$A &&" \
+ && $test_line2 == "// ./\$A.out -pass 0 >tmp.go && \$G tmp.go && \$L -o \$A.out1 tmp.\$A && ./\$A.out1 &&" \
+ && $test_line3 == "// ./\$A.out -pass 1 >tmp.go && errchk \$G -e tmp.go &&" \
+ && $test_line4 == "// ./\$A.out -pass 2 >tmp.go && errchk \$G -e tmp.go" } {
+ set go_execute_args ""
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "link"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ if [isnative] {
+ if { [catch "exec $output_file -pass 0 >tmp.go"] != 0 } {
+ fail "$name execution 0"
+ } else {
+ pass "$name execution 0"
+ file delete tmp.x
+ # Disable optimizations as this test takes a long time
+ # to compile.
+ set TORTURE_OPTIONS [list { -O0 -g -fno-var-tracking-assignments }]
+ go-torture-execute "./tmp.go"
+ }
+ if { [catch "exec $output_file -pass 1 >tmp.go"] != 0 } {
+ fail "$name execution 1"
+ } else {
+ pass "$name execution 1"
+ errchk tmp.go ""
+ }
+ if { [catch "exec $output_file -pass 2 >tmp.go"] != 0 } {
+ fail "$name execution 2"
+ } else {
+ pass "$name execution 2"
+ errchk tmp.go ""
+ }
+ file delete tmp.go
+ }
+ file delete $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/\$F.go && \$L \$F.\$A && ./\$A.out >tmp.go &&" \
+ && $test_line2 == "// errchk \$G -e tmp.go" } {
+ set go_execute_args ""
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "link"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ if [isnative] {
+ if { [catch "exec $output_file >tmp.go"] != 0 } {
+ fail "$name execution"
+ } else {
+ pass "$name execution"
+ file delete tmp.x
+ errchk tmp.go ""
+ }
+ }
+ file delete $output_file
+ set runtests $hold_runtests
+ } elseif { $test_line == "// errchk \$G -e \$D/\$F.dir/\[ab\].go" } {
+ regsub "\\.go$" $test ".dir/a.go" file1
+ regsub "\\.go$" $test ".dir/b.go" file2
+ errchk "$file1" "$file2"
+ } elseif { $test_line == "// \$G -N -o slow.\$A \$D/bug369.dir/pkg.go &&" \
+ && $test_line2 == "// \$G -o fast.\$A \$D/bug369.dir/pkg.go &&" \
+ && $test_line3 == "// run" } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/pkg.go" file1
+ dg-test -keep-output $file1 "" "-fgo-prefix=slow -w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ file rename -force $ofile1 slow.o
+ dg-test -keep-output $file1 "-O2" "-fgo-prefix=fast -w $DEFAULT_GOCFLAGS"
+ file rename -force $ofile1 fast.o
+ set ofile2 "[file rootname [file tail $test]].o"
+ dg-test -keep-output $test "-O" "-w $DEFAULT_GOCFLAGS"
+ set output_file "./[file rootname [file tail $test]].exe"
+ set comp_output [go_target_compile "$ofile2 slow.o fast.o" \
+ $output_file "executable" "$options"]
+ set comp_output [go-dg-prune $target_triplet $comp_output]
+ if [string match "" $comp_output] {
+ set result [go_load "$output_file" "" ""]
+ set status [lindex $result 0]
+ $status $name
+ } else {
+ verbose -log $comp_output
+ fail $name
+ }
+ file delete slow.o fast.o $ofile2 $output_file
+ set runtests $hold_runtests
+ } elseif { [string match \
+ "// \$G \$D/\$F.dir/pkg.go && \$G \$D/\$F.go || echo *" \
+ $test_line ] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/pkg.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ dg-test $test "-O" "-w $DEFAULT_GOCFLAGS"
+ file delete "[file rootname [file tail $file1]].o"
+ set runtests $hold_runtests
+ } elseif { [string match "// \$G \$D/\$F.dir/one.go && \$G \$D/\$F.dir/two.go || echo BUG*" \
+ $test_line ] } {
+ set hold_runtests $runtests
+ set runtests "go-test.exp"
+ set dg-do-what-default "assemble"
+ regsub "\\.go$" $test ".dir/one.go" file1
+ dg-test -keep-output $file1 "-O" "-w $DEFAULT_GOCFLAGS"
+ set ofile1 "[file rootname [file tail $file1]].o"
+ regsub "\\.go$" $test ".dir/two.go" file2
+ dg-test $file2 "-O" "-w $DEFAULT_GOCFLAGS"
+ file delete $ofile1
+ set runtests $hold_runtests
+ } elseif { $test_line == "// \$G \$D/bug302.dir/p.go && pack grc pp.a p.\$A && \$G \$D/bug302.dir/main.go" \
+ || $test_line == "// \$G \$D/empty.go && errchk \$G \$D/\$F.go" } {
+ # These tests import the same package under two different
+ # names, which gccgo does not support.
+ } elseif { $test_line == "// \$G -S \$D/\$F.go | egrep initdone >/dev/null && echo BUG sinit || true" } {
+ # This tests whether initializers are written out
+ # statically. gccgo does not provide a way to test that,
+ # as an initializer will be generated for any code which
+ # has global variables which need to be registered as GC
+ # roots.
+ } elseif { $test_line == "// errorcheck -0 -m"
+ || $test_line == "// errorcheck -0 -m -l" } {
+ # This tests debug output of the gc compiler, which is
+ # meaningless for gccgo.
+ } elseif { $test_line == "// \[ \$A == 6 \] || errchk \$G -e \$D/\$F.go" \
+ || $test_line == "// \[ \$A != 6 \] || errchk \$G -e \$D/\$F.go" } {
+ # This tests specific handling of the gc compiler on types
+ # that are too large. It is target specific in a way I
+ # haven't bothered to check for here.
+ } elseif { $test_line == "// \$G \$D/\$F.go && \$L -X main.tbd hello \$F.\$A && ./\$A.out" } {
+ # This tests the gc ld -X option, which gccgo does not
+ # support.
+ } elseif { $test_line == "// \$G \$D/pkg.go && pack grc pkg.a pkg.\$A 2> /dev/null && rm pkg.\$A && errchk \$G -I. -u \$D/main.go"
+ || $test_line == "// \$G \$D/pkg.go && pack grcS pkg.a pkg.\$A 2> /dev/null && rm pkg.\$A && \$G -I. -u \$D/main.go" } {
+ # This tests the gc -u option, which gccgo does not
+ # support.
+ } elseif { $test_line == "// errorcheck -0 -N -d=nil" \
+ || $test_line == "// errorcheck -0 -d=nil" } {
+ # This tests gc nil pointer checks using -d=nil, which
+ # gccgo does not support.
+ } else {
+ clone_output "$name: unrecognized test line: $test_line"
+ unsupported $name
+ }
+
+ set go_compile_args ""
+ set go_execute_args ""
+ set TORTURE_OPTIONS [list { -O2 -g }]
+ }
+
+ set dg-do-what-default ${saved-dg-do-what-default}
+ set TORTURE_OPTIONS $saved_torture_options
+}
+
+go-gc-tests
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/235.go b/gcc-4.9/gcc/testsuite/go.test/test/235.go
new file mode 100644
index 0000000..6745dde
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/235.go
@@ -0,0 +1,75 @@
+// run
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Solve the 2,3,5 problem (print all numbers with 2, 3, or 5 as factor) using channels.
+// Test the solution, silently.
+
+package main
+
+type T chan uint64
+
+func M(f uint64) (in, out T) {
+ in = make(T, 100)
+ out = make(T, 100)
+ go func(in, out T, f uint64) {
+ for {
+ out <- f*<-in
+ }
+ }(in, out, f)
+ return in, out
+}
+
+
+func min(xs []uint64) uint64 {
+ m := xs[0]
+ for i := 1; i < len(xs); i++ {
+ if xs[i] < m {
+ m = xs[i]
+ }
+ }
+ return m
+}
+
+
+func main() {
+ F := []uint64{2, 3, 5}
+ var n = len(F)
+ OUT := []uint64{
+ 2, 3, 4, 5, 6, 8, 9, 10, 12, 15, 16, 18, 20, 24, 25, 27, 30, 32, 36,
+ 40, 45, 48, 50, 54, 60, 64, 72, 75, 80, 81, 90, 96, 100, 108, 120, 125,
+ 128, 135, 144, 150, 160, 162, 180, 192, 200, 216, 225, 240, 243, 250,
+ 256, 270, 288, 300, 320, 324, 360, 375, 384, 400, 405, 432, 450, 480,
+ 486, 500, 512, 540, 576, 600, 625, 640, 648, 675, 720, 729, 750, 768,
+ 800, 810, 864, 900, 960, 972, 1000, 1024, 1080, 1125, 1152, 1200, 1215,
+ 1250, 1280, 1296, 1350, 1440, 1458, 1500, 1536, 1600}
+
+ x := uint64(1)
+ ins := make([]T, n)
+ outs := make([]T, n)
+ xs := make([]uint64, n)
+ for i := 0; i < n; i++ {
+ ins[i], outs[i] = M(F[i])
+ xs[i] = x
+ }
+
+ for i := 0; i < len(OUT); i++ {
+ for i := 0; i < n; i++ {
+ ins[i] <- x
+ }
+
+ for i := 0; i < n; i++ {
+ if xs[i] == x {
+ xs[i] = <-outs[i]
+ }
+ }
+
+ x = min(xs)
+ if x != OUT[i] {
+ println("bad: ", x, " should be ", OUT[i])
+ panic("235")
+ }
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/64bit.go b/gcc-4.9/gcc/testsuite/go.test/test/64bit.go
new file mode 100644
index 0000000..d99d8e8
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/64bit.go
@@ -0,0 +1,728 @@
+// runoutput
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Generate test of 64-bit arithmetic.
+// Most synthesized routines have different cases for
+// constants vs variables and even the generated code has
+// different cases for large and small constants,
+// so try a good range of inputs.
+
+package main
+
+import (
+ "bufio"
+ "fmt"
+ "os"
+)
+
+var bout *bufio.Writer
+
+// 64-bit math without using 64-bit numbers,
+// so that we can generate the test program even
+// if the compiler has buggy or missing 64-bit support.
+
+type Uint64 struct {
+ hi uint32
+ lo uint32
+}
+
+type Int64 struct {
+ hi int32
+ lo uint32
+}
+
+func (a Uint64) Int64() (c Int64) {
+ c.hi = int32(a.hi)
+ c.lo = a.lo
+ return
+}
+
+func (a Uint64) Cmp(b Uint64) int {
+ switch {
+ case a.hi < b.hi:
+ return -1
+ case a.hi > b.hi:
+ return 1
+ case a.lo < b.lo:
+ return -1
+ case a.lo > b.lo:
+ return 1
+ }
+ return 0
+}
+
+func (a Uint64) LeftShift(b uint) (c Uint64) {
+ switch {
+ case b >= 64:
+ c.hi = 0
+ c.lo = 0
+ case b >= 32:
+ c.hi = a.lo << (b - 32)
+ c.lo = 0
+ default:
+ c.hi = a.hi<<b | a.lo>>(32-b)
+ c.lo = a.lo << b
+ }
+ return
+}
+
+func (a Uint64) RightShift(b uint) (c Uint64) {
+ switch {
+ case b >= 64:
+ c.hi = 0
+ c.lo = a.hi
+ case b >= 32:
+ c.hi = 0
+ c.lo = a.hi >> (b - 32)
+ default:
+ c.hi = a.hi >> b
+ c.lo = a.hi<<(32-b) | a.lo>>b
+ }
+ return
+}
+
+func (a Uint64) LeftShift64(b Uint64) (c Uint64) {
+ if b.hi != 0 || b.lo >= 64 {
+ return
+ }
+ return a.LeftShift(uint(b.lo))
+}
+
+func (a Uint64) RightShift64(b Uint64) (c Uint64) {
+ if b.hi != 0 || b.lo >= 64 {
+ return
+ }
+ return a.RightShift(uint(b.lo))
+}
+
+func (a Uint64) Plus(b Uint64) (c Uint64) {
+ var carry uint32
+ if c.lo = a.lo + b.lo; c.lo < a.lo {
+ carry = 1
+ }
+ c.hi = a.hi + b.hi + carry
+ return
+}
+
+func (a Uint64) Minus(b Uint64) (c Uint64) {
+ var borrow uint32
+ if c.lo = a.lo - b.lo; c.lo > a.lo {
+ borrow = 1
+ }
+ c.hi = a.hi - b.hi - borrow
+ return
+}
+
+func (a Uint64) Neg() (c Uint64) {
+ var zero Uint64
+ return zero.Minus(a)
+}
+
+func (a Uint64) Com() (c Uint64) {
+ c.hi = ^a.hi
+ c.lo = ^a.lo
+ return
+}
+
+func (a Uint64) Len() int {
+ switch {
+ case a.hi != 0:
+ for i := 31; i >= 0; i-- {
+ if a.hi&(1<<uint(i)) != 0 {
+ return i + 1 + 32
+ }
+ }
+ case a.lo != 0:
+ for i := 31; i >= 0; i-- {
+ if a.lo&(1<<uint(i)) != 0 {
+ return i + 1
+ }
+ }
+ }
+ return 0
+}
+
+func (a Uint64) HasBit(b uint) bool {
+ switch {
+ case b >= 64:
+ return false
+ case b >= 32:
+ return a.hi&(1<<(b-32)) != 0
+ }
+ return a.lo&(1<<b) != 0
+}
+
+func (a Uint64) Times(b Uint64) (c Uint64) {
+ for i := uint(0); i < 64; i++ {
+ if b.HasBit(i) {
+ c = c.Plus(a.LeftShift(i))
+ }
+ }
+ return
+}
+
+func (a Uint64) DivMod(b Uint64) (quo, rem Uint64) {
+ n := a.Len() - b.Len()
+ if n >= 0 {
+ b = b.LeftShift(uint(n))
+ for i := 0; i <= n; i++ {
+ quo = quo.LeftShift(1)
+ if b.Cmp(a) <= 0 { // b <= a
+ quo.lo |= 1
+ a = a.Minus(b)
+ }
+ b = b.RightShift(1)
+ }
+ }
+ rem = a
+ return
+}
+
+func (a Uint64) And(b Uint64) (c Uint64) {
+ c.hi = a.hi & b.hi
+ c.lo = a.lo & b.lo
+ return
+}
+
+func (a Uint64) AndNot(b Uint64) (c Uint64) {
+ c.hi = a.hi &^ b.hi
+ c.lo = a.lo &^ b.lo
+ return
+}
+
+func (a Uint64) Or(b Uint64) (c Uint64) {
+ c.hi = a.hi | b.hi
+ c.lo = a.lo | b.lo
+ return
+}
+
+func (a Uint64) Xor(b Uint64) (c Uint64) {
+ c.hi = a.hi ^ b.hi
+ c.lo = a.lo ^ b.lo
+ return
+}
+
+func (a Uint64) String() string { return fmt.Sprintf("%#x%08x", a.hi, a.lo) }
+
+func (a Int64) Uint64() (c Uint64) {
+ c.hi = uint32(a.hi)
+ c.lo = a.lo
+ return
+}
+
+func (a Int64) Cmp(b Int64) int {
+ // Same body as Uint64.Cmp,
+ // but behaves differently
+ // because hi is uint32 not int32.
+ switch {
+ case a.hi < b.hi:
+ return -1
+ case a.hi > b.hi:
+ return 1
+ case a.lo < b.lo:
+ return -1
+ case a.lo > b.lo:
+ return 1
+ }
+ return 0
+}
+
+func (a Int64) LeftShift(b uint) (c Int64) { return a.Uint64().LeftShift(b).Int64() }
+
+func (a Int64) RightShift(b uint) (c Int64) {
+ switch {
+ case b >= 64:
+ c.hi = a.hi >> 31 // sign extend
+ c.lo = uint32(c.hi)
+ case b >= 32:
+ c.hi = a.hi >> 31 // sign extend
+ c.lo = uint32(a.hi >> (b - 32))
+ default:
+ c.hi = a.hi >> b
+ c.lo = uint32(a.hi<<(32-b)) | a.lo>>b
+ }
+ return
+}
+
+func (a Int64) LeftShift64(b Uint64) (c Int64) {
+ if b.hi != 0 || b.lo >= 64 {
+ return
+ }
+ return a.LeftShift(uint(b.lo))
+}
+
+func (a Int64) RightShift64(b Uint64) (c Int64) {
+ if b.hi != 0 || b.lo >= 64 {
+ return a.RightShift(64)
+ }
+ return a.RightShift(uint(b.lo))
+}
+
+func (a Int64) Plus(b Int64) (c Int64) { return a.Uint64().Plus(b.Uint64()).Int64() }
+
+func (a Int64) Minus(b Int64) (c Int64) { return a.Uint64().Minus(b.Uint64()).Int64() }
+
+func (a Int64) Neg() (c Int64) { return a.Uint64().Neg().Int64() }
+
+func (a Int64) Com() (c Int64) { return a.Uint64().Com().Int64() }
+
+func (a Int64) Times(b Int64) (c Int64) { return a.Uint64().Times(b.Uint64()).Int64() }
+
+func (a Int64) DivMod(b Int64) (quo Int64, rem Int64) {
+ var zero Int64
+
+ quoSign := +1
+ remSign := +1
+ if a.Cmp(zero) < 0 {
+ quoSign = -1
+ remSign = -1
+ a = a.Neg()
+ }
+ if b.Cmp(zero) < 0 {
+ quoSign = -quoSign
+ b = b.Neg()
+ }
+
+ q, r := a.Uint64().DivMod(b.Uint64())
+ quo = q.Int64()
+ rem = r.Int64()
+
+ if quoSign < 0 {
+ quo = quo.Neg()
+ }
+ if remSign < 0 {
+ rem = rem.Neg()
+ }
+ return
+}
+
+func (a Int64) And(b Int64) (c Int64) { return a.Uint64().And(b.Uint64()).Int64() }
+
+func (a Int64) AndNot(b Int64) (c Int64) { return a.Uint64().AndNot(b.Uint64()).Int64() }
+
+func (a Int64) Or(b Int64) (c Int64) { return a.Uint64().Or(b.Uint64()).Int64() }
+
+func (a Int64) Xor(b Int64) (c Int64) { return a.Uint64().Xor(b.Uint64()).Int64() }
+
+func (a Int64) String() string {
+ if a.hi < 0 {
+ return fmt.Sprintf("-%s", a.Neg().Uint64())
+ }
+ return a.Uint64().String()
+}
+
+var int64Values = []Int64{
+ Int64{0, 0},
+ Int64{0, 1},
+ Int64{0, 2},
+ Int64{0, 3},
+ Int64{0, 100},
+ Int64{0, 10001},
+ Int64{0, 1<<31 - 1},
+ Int64{0, 1 << 31},
+ Int64{0, 1<<31 + 1},
+ Int64{0, 1<<32 - 1<<30},
+ Int64{0, 1<<32 - 1},
+ Int64{1, 0},
+ Int64{1, 1},
+ Int64{2, 0},
+ Int64{1<<31 - 1, 1<<32 - 10000},
+ Int64{1<<31 - 1, 1<<32 - 1},
+ Int64{0x789abcde, 0xf0123456},
+
+ Int64{-1, 1<<32 - 1},
+ Int64{-1, 1<<32 - 2},
+ Int64{-1, 1<<32 - 3},
+ Int64{-1, 1<<32 - 100},
+ Int64{-1, 1<<32 - 10001},
+ Int64{-1, 1<<32 - (1<<31 - 1)},
+ Int64{-1, 1<<32 - 1<<31},
+ Int64{-1, 1<<32 - (1<<31 + 1)},
+ Int64{-1, 1<<32 - (1<<32 - 1<<30)},
+ Int64{-1, 0},
+ Int64{-1, 1},
+ Int64{-2, 0},
+ Int64{-(1 << 31), 10000},
+ Int64{-(1 << 31), 1},
+ Int64{-(1 << 31), 0},
+ Int64{-0x789abcde, 0xf0123456},
+}
+
+var uint64Values = []Uint64{
+ Uint64{0, 0},
+ Uint64{0, 1},
+ Uint64{0, 2},
+ Uint64{0, 3},
+ Uint64{0, 100},
+ Uint64{0, 10001},
+ Uint64{0, 1<<31 - 1},
+ Uint64{0, 1 << 31},
+ Uint64{0, 1<<31 + 1},
+ Uint64{0, 1<<32 - 1<<30},
+ Uint64{0, 1<<32 - 1},
+ Uint64{1, 0},
+ Uint64{1, 1},
+ Uint64{2, 0},
+ Uint64{1<<31 - 1, 1<<32 - 10000},
+ Uint64{1<<31 - 1, 1<<32 - 1},
+ Uint64{1<<32 - 1<<30, 0},
+ Uint64{1<<32 - 1, 0},
+ Uint64{1<<32 - 1, 1<<32 - 100},
+ Uint64{1<<32 - 1, 1<<32 - 1},
+ Uint64{0x789abcde, 0xf0123456},
+ Uint64{0xfedcba98, 0x76543210},
+}
+
+var shiftValues = []Uint64{
+ Uint64{0, 0},
+ Uint64{0, 1},
+ Uint64{0, 2},
+ Uint64{0, 3},
+ Uint64{0, 15},
+ Uint64{0, 16},
+ Uint64{0, 17},
+ Uint64{0, 31},
+ Uint64{0, 32},
+ Uint64{0, 33},
+ Uint64{0, 61},
+ Uint64{0, 62},
+ Uint64{0, 63},
+ Uint64{0, 64},
+ Uint64{0, 65},
+ Uint64{0, 1<<32 - 1},
+ Uint64{1, 0},
+ Uint64{1, 1},
+ Uint64{1 << 28, 0},
+ Uint64{1 << 31, 0},
+ Uint64{1<<32 - 1, 0},
+ Uint64{1<<32 - 1, 1<<32 - 1},
+}
+
+var ntest = 0
+
+// Part 1 is tests of variable operations; generic functions
+// called by repetitive code. Could make a table but not worth it.
+
+const prolog = "\n" +
+ "package main\n" +
+ "\n" +
+ "import \"os\"\n" +
+ "\n" +
+ "var ok = true\n" +
+ "\n" +
+ "func testInt64Unary(a, plus, xor, minus int64) {\n" +
+ " if n, op, want := +a, `+`, plus; n != want { ok=false; println(`int64`, op, a, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := ^a, `^`, xor; n != want { ok=false; println(`int64`, op, a, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := -a, `-`, minus; n != want { ok=false; println(`int64`, op, a, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n" +
+ "func testInt64Binary(a, b, add, sub, mul, div, mod, and, or, xor, andnot int64, dodiv bool) {\n" +
+ " if n, op, want := a + b, `+`, add; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a - b, `-`, sub; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a * b, `*`, mul; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if dodiv {\n" +
+ " if n, op, want := a / b, `/`, div; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a % b, `%`, mod; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if n, op, want := a & b, `&`, and; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a | b, `|`, or; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a ^ b, `^`, xor; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a &^ b, `&^`, andnot; n != want { ok=false; println(`int64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n" +
+ "func testInt64Shift(a int64, b uint64, left, right int64) {\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`int64`, a, op, `uint64`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`int64`, a, op, `uint64`, s, `=`, n, `should be`, want); }\n" +
+ " if uint64(uint(b)) == b {\n" +
+ " b := uint(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`int64`, a, op, `uint`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`int64`, a, op, `uint`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint32(b)) == b {\n" +
+ " b := uint32(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`int64`, a, op, `uint32`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`int64`, a, op, `uint32`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint16(b)) == b {\n" +
+ " b := uint16(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`int64`, a, op, `uint16`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`int64`, a, op, `uint16`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint8(b)) == b {\n" +
+ " b := uint8(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`int64`, a, op, `uint8`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`int64`, a, op, `uint8`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ "}\n" +
+ "\n" +
+ "func testUint64Unary(a, plus, xor, minus uint64) {\n" +
+ " if n, op, want := +a, `+`, plus; n != want { ok=false; println(`uint64`, op, a, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := ^a, `^`, xor; n != want { ok=false; println(`uint64`, op, a, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := -a, `-`, minus; n != want { ok=false; println(`uint64`, op, a, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n" +
+ "func testUint64Binary(a, b, add, sub, mul, div, mod, and, or, xor, andnot uint64, dodiv bool) {\n" +
+ " if n, op, want := a + b, `+`, add; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a - b, `-`, sub; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a * b, `*`, mul; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if dodiv {\n" +
+ " if n, op, want := a / b, `/`, div; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a % b, `%`, mod; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if n, op, want := a & b, `&`, and; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a | b, `|`, or; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a ^ b, `^`, xor; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a &^ b, `&^`, andnot; n != want { ok=false; println(`uint64`, a, op, b, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n" +
+ "func testUint64Shift(a, b, left, right uint64) {\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`uint64`, a, op, `uint64`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`uint64`, a, op, `uint64`, s, `=`, n, `should be`, want); }\n" +
+ " if uint64(uint(b)) == b {\n" +
+ " b := uint(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`uint64`, a, op, `uint`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`uint64`, a, op, `uint`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint32(b)) == b {\n" +
+ " b := uint32(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`uint64`, a, op, `uint32`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`uint64`, a, op, `uint32`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint16(b)) == b {\n" +
+ " b := uint16(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`uint64`, a, op, `uint16`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`uint64`, a, op, `uint16`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if uint64(uint8(b)) == b {\n" +
+ " b := uint8(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(`uint64`, a, op, `uint8`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(`uint64`, a, op, `uint8`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ "}\n" +
+ "\n"
+
+func varTests() {
+ fmt.Fprint(bout, prolog)
+ for _, a := range int64Values {
+ fmt.Fprintf(bout, "func test%v() {\n", ntest)
+ ntest++
+ fmt.Fprintf(bout, "\ttestInt64Unary(%v, %v, %v, %v);\n", a, a, a.Com(), a.Neg())
+ for _, b := range int64Values {
+ var div, mod Int64
+ dodiv := false
+ var zero Int64
+ if b.Cmp(zero) != 0 { // b != 0
+ // Can't divide by zero but also can't divide -0x8000...000 by -1.
+ var bigneg = Int64{-0x80000000, 0}
+ var minus1 = Int64{-1, ^uint32(0)}
+ if a.Cmp(bigneg) != 0 || b.Cmp(minus1) != 0 { // a != -1<<63 || b != -1
+ div, mod = a.DivMod(b)
+ dodiv = true
+ }
+ }
+ fmt.Fprintf(bout, "\ttestInt64Binary(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ a, b, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ }
+ for _, b := range shiftValues {
+ fmt.Fprintf(bout, "\ttestInt64Shift(%v, %v, %v, %v);\n",
+ a, b, a.LeftShift64(b), a.RightShift64(b))
+ }
+ fmt.Fprintf(bout, "}\n")
+ }
+
+ for _, a := range uint64Values {
+ fmt.Fprintf(bout, "func test%v() {\n", ntest)
+ ntest++
+ fmt.Fprintf(bout, "\ttestUint64Unary(%v, %v, %v, %v);\n", a, a, a.Com(), a.Neg())
+ for _, b := range uint64Values {
+ var div, mod Uint64
+ dodiv := false
+ var zero Uint64
+ if b.Cmp(zero) != 0 { // b != 0
+ div, mod = a.DivMod(b)
+ dodiv = true
+ }
+ fmt.Fprintf(bout, "\ttestUint64Binary(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ a, b, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ }
+ for _, b := range shiftValues {
+ fmt.Fprintf(bout, "\ttestUint64Shift(%v, %v, %v, %v);\n",
+ a, b, a.LeftShift64(b), a.RightShift64(b))
+ }
+ fmt.Fprintf(bout, "}\n")
+ }
+}
+
+// Part 2 is tests of operations involving one variable and one constant.
+
+const binaryConstL = "func test%vBinaryL%v(b, add, sub, mul, div, mod, and, or, xor, andnot %v, dodiv bool) {\n" +
+ " const a %v = %v;\n" +
+ " const typ = `%s`;\n" +
+ " if n, op, want := a + b, `+`, add; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a - b, `-`, sub; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a * b, `*`, mul; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if dodiv {\n" +
+ " if n, op, want := a / b, `/`, div; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a %% b, `%%`, mod; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if n, op, want := a & b, `&`, and; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a | b, `|`, or; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a ^ b, `^`, xor; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a &^ b, `&^`, andnot; n != want { ok=false; println(typ, `const`, a, op, `var`, b, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n"
+
+const binaryConstR = "func test%vBinaryR%v(a, add, sub, mul, div, mod, and, or, xor, andnot %v, dodiv bool) {\n" +
+ " const b %v = %v;\n" +
+ " const typ = `%s`;\n" +
+ " if n, op, want := a + b, `+`, add; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a - b, `-`, sub; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a * b, `*`, mul; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if dodiv {\n" +
+ " if n, op, want := a / b, `/`, div; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a %% b, `%%`, mod; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ " if n, op, want := a & b, `&`, and; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a | b, `|`, or; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a ^ b, `^`, xor; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a &^ b, `&^`, andnot; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n"
+
+const binaryConstR0 = "func test%vBinaryR%v(a, add, sub, mul, div, mod, and, or, xor, andnot %v, dodiv bool) {\n" +
+ " const b %v = %v;\n" +
+ " const typ = `%s`;\n" +
+ " if n, op, want := a + b, `+`, add; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a - b, `-`, sub; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a * b, `*`, mul; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a & b, `&`, and; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a | b, `|`, or; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a ^ b, `^`, xor; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ " if n, op, want := a &^ b, `&^`, andnot; n != want { ok=false; println(typ, `var`, a, op, `const`, b, `=`, n, `should be`, want); }\n" +
+ "}\n" +
+ "\n"
+
+const shiftConstL = "func test%vShiftL%v(b uint64, left, right %v) {\n" +
+ " const a %v = %v;\n" +
+ " const typ = `%s`;\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(typ, `const`, a, op, `var`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(typ, `const`, a, op, `var`, s, `=`, n, `should be`, want); }\n" +
+ " if uint64(uint32(b)) == b {\n" +
+ " b := uint32(b);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(typ, `const`, a, op, `var`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(typ, `const`, a, op, `var`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ "}\n"
+
+const shiftConstR = "func test%vShiftR%v(a, left, right %v) {\n" +
+ " const b uint64 = %v;\n" +
+ " const typ = `%s`;\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(typ, `var`, a, op, `const`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(typ, `var`, a, op, `const`, s, `=`, n, `should be`, want); }\n" +
+ " if b & 0xffffffff == b {\n" +
+ " const b = uint32(b & 0xffffffff);\n" +
+ " if n, op, s, want := a << b, `<<`, b, left; n != want { ok=false; println(typ, `var`, a, op, `const`, s, `=`, n, `should be`, want); }\n" +
+ " if n, op, s, want := a >> b, `>>`, b, right; n != want { ok=false; println(typ, `var`, a, op, `const`, s, `=`, n, `should be`, want); }\n" +
+ " }\n" +
+ "}\n"
+
+func constTests() {
+ for i, a := range int64Values {
+ fmt.Fprintf(bout, binaryConstL, "Int64", i, "int64", "int64", a, "int64")
+ if a.hi == 0 && a.lo == 0 {
+ fmt.Fprintf(bout, binaryConstR0, "Int64", i, "int64", "int64", a, "int64")
+ } else {
+ fmt.Fprintf(bout, binaryConstR, "Int64", i, "int64", "int64", a, "int64")
+ }
+ fmt.Fprintf(bout, shiftConstL, "Int64", i, "int64", "int64", a, "int64")
+ }
+ for i, a := range uint64Values {
+ fmt.Fprintf(bout, binaryConstL, "Uint64", i, "uint64", "uint64", a, "uint64")
+ if a.hi == 0 && a.lo == 0 {
+ fmt.Fprintf(bout, binaryConstR0, "Uint64", i, "uint64", "uint64", a, "uint64")
+ } else {
+ fmt.Fprintf(bout, binaryConstR, "Uint64", i, "uint64", "uint64", a, "uint64")
+ }
+ fmt.Fprintf(bout, shiftConstL, "Uint64", i, "uint64", "uint64", a, "uint64")
+ }
+ for i, a := range shiftValues {
+ fmt.Fprintf(bout, shiftConstR, "Int64", i, "int64", a, "int64")
+ fmt.Fprintf(bout, shiftConstR, "Uint64", i, "uint64", a, "uint64")
+ }
+ for i, a := range int64Values {
+ fmt.Fprintf(bout, "func test%v() {\n", ntest)
+ ntest++
+ for j, b := range int64Values {
+ var div, mod Int64
+ dodiv := false
+ var zero Int64
+ if b.Cmp(zero) != 0 { // b != 0
+ // Can't divide by zero but also can't divide -0x8000...000 by -1.
+ var bigneg = Int64{-0x80000000, 0}
+ var minus1 = Int64{-1, ^uint32(0)}
+ if a.Cmp(bigneg) != 0 || b.Cmp(minus1) != 0 { // a != -1<<63 || b != -1
+ div, mod = a.DivMod(b)
+ dodiv = true
+ }
+ }
+ fmt.Fprintf(bout, "\ttestInt64BinaryL%v(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ i, b, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ fmt.Fprintf(bout, "\ttestInt64BinaryR%v(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ j, a, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ }
+ for j, b := range shiftValues {
+ fmt.Fprintf(bout, "\ttestInt64ShiftL%v(%v, %v, %v);\n",
+ i, b, a.LeftShift64(b), a.RightShift64(b))
+ fmt.Fprintf(bout, "\ttestInt64ShiftR%v(%v, %v, %v);\n",
+ j, a, a.LeftShift64(b), a.RightShift64(b))
+ }
+ fmt.Fprintf(bout, "}\n")
+ }
+ for i, a := range uint64Values {
+ fmt.Fprintf(bout, "func test%v() {\n", ntest)
+ ntest++
+ for j, b := range uint64Values {
+ var div, mod Uint64
+ dodiv := false
+ var zero Uint64
+ if b.Cmp(zero) != 0 { // b != 0
+ div, mod = a.DivMod(b)
+ dodiv = true
+ }
+ fmt.Fprintf(bout, "\ttestUint64BinaryL%v(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ i, b, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ fmt.Fprintf(bout, "\ttestUint64BinaryR%v(%v, %v, %v, %v, %v, %v, %v, %v, %v, %v, %v);\n",
+ j, a, a.Plus(b), a.Minus(b), a.Times(b), div, mod,
+ a.And(b), a.Or(b), a.Xor(b), a.AndNot(b), dodiv)
+ }
+ for j, b := range shiftValues {
+ fmt.Fprintf(bout, "\ttestUint64ShiftL%v(%v, %v, %v);\n",
+ i, b, a.LeftShift64(b), a.RightShift64(b))
+ fmt.Fprintf(bout, "\ttestUint64ShiftR%v(%v, %v, %v);\n",
+ j, a, a.LeftShift64(b), a.RightShift64(b))
+ }
+ fmt.Fprintf(bout, "}\n")
+ }
+}
+
+func main() {
+ bout = bufio.NewWriter(os.Stdout)
+ varTests()
+ constTests()
+
+ fmt.Fprintf(bout, "func main() {\n")
+ for i := 0; i < ntest; i++ {
+ fmt.Fprintf(bout, "\ttest%v();\n", i)
+ }
+ fmt.Fprintf(bout, "\tif !ok { os.Exit(1) }\n")
+ fmt.Fprintf(bout, "}\n")
+ bout.Flush()
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/README.gcc b/gcc-4.9/gcc/testsuite/go.test/test/README.gcc
new file mode 100644
index 0000000..446110f
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/README.gcc
@@ -0,0 +1,7 @@
+This directory is an exact copy (except for this file) of the Go
+testsuite from the test subdirectory of http://code.google.com/p/go.
+This is here so that we run the same tests as the gc Go compiler. We
+do not, however, run the tests in the same way. The gc compiler uses
+the run shell script in this directory. For gccgo, we use the file
+go-test.exp in the parent directory to run the tests in gcc's usual
+DejaGNU test harness.
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/alias.go b/gcc-4.9/gcc/testsuite/go.test/test/alias.go
new file mode 100644
index 0000000..ec93a2d
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/alias.go
@@ -0,0 +1,33 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that error messages say what the source file says
+// (uint8 vs byte, int32 vs. rune).
+// Does not compile.
+
+package main
+
+import (
+ "fmt"
+ "unicode/utf8"
+)
+
+func f(byte) {}
+func g(uint8) {}
+
+func main() {
+ var x float64
+ f(x) // ERROR "byte"
+ g(x) // ERROR "uint8"
+
+ // Test across imports.
+
+ var ff fmt.Formatter
+ var fs fmt.State
+ ff.Format(fs, x) // ERROR "rune"
+
+ utf8.RuneStart(x) // ERROR "byte"
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/alias1.go b/gcc-4.9/gcc/testsuite/go.test/test/alias1.go
new file mode 100644
index 0000000..42cf693
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/alias1.go
@@ -0,0 +1,54 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that dynamic interface checks treat byte=uint8
+// and rune=int or rune=int32.
+
+package main
+
+func main() {
+ var x interface{}
+
+ x = byte(1)
+ switch x.(type) {
+ case uint8:
+ // ok
+ default:
+ panic("byte != uint8")
+ }
+
+ x = uint8(2)
+ switch x.(type) {
+ case byte:
+ // ok
+ default:
+ panic("uint8 != byte")
+ }
+
+ rune32 := false
+ x = rune(3)
+ switch x.(type) {
+ case int:
+ // ok
+ case int32:
+ // must be new code
+ rune32 = true
+ default:
+ panic("rune != int and rune != int32")
+ }
+
+ if rune32 {
+ x = int32(4)
+ } else {
+ x = int(5)
+ }
+ switch x.(type) {
+ case rune:
+ // ok
+ default:
+ panic("int (or int32) != rune")
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/append.go b/gcc-4.9/gcc/testsuite/go.test/test/append.go
new file mode 100644
index 0000000..3f6251e
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/append.go
@@ -0,0 +1,247 @@
+// run
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Semi-exhaustive test for the append predeclared function.
+
+package main
+
+import (
+ "fmt"
+ "reflect"
+)
+
+
+func verify(name string, result, expected interface{}) {
+ if !reflect.DeepEqual(result, expected) {
+ panic(name)
+ }
+}
+
+
+func main() {
+ for _, t := range tests {
+ verify(t.name, t.result, t.expected)
+ }
+ verifyStruct()
+ verifyInterface()
+ verifyType()
+}
+
+
+var tests = []struct {
+ name string
+ result, expected interface{}
+}{
+ {"bool a", append([]bool{}), []bool{}},
+ {"bool b", append([]bool{}, true), []bool{true}},
+ {"bool c", append([]bool{}, true, false, true, true), []bool{true, false, true, true}},
+
+ {"bool d", append([]bool{true, false, true}), []bool{true, false, true}},
+ {"bool e", append([]bool{true, false, true}, false), []bool{true, false, true, false}},
+ {"bool f", append([]bool{true, false, true}, false, false, false), []bool{true, false, true, false, false, false}},
+
+ {"bool g", append([]bool{}, []bool{true}...), []bool{true}},
+ {"bool h", append([]bool{}, []bool{true, false, true, false}...), []bool{true, false, true, false}},
+
+ {"bool i", append([]bool{true, false, true}, []bool{true}...), []bool{true, false, true, true}},
+ {"bool j", append([]bool{true, false, true}, []bool{true, true, true}...), []bool{true, false, true, true, true, true}},
+
+
+ {"byte a", append([]byte{}), []byte{}},
+ {"byte b", append([]byte{}, 0), []byte{0}},
+ {"byte c", append([]byte{}, 0, 1, 2, 3), []byte{0, 1, 2, 3}},
+
+ {"byte d", append([]byte{0, 1, 2}), []byte{0, 1, 2}},
+ {"byte e", append([]byte{0, 1, 2}, 3), []byte{0, 1, 2, 3}},
+ {"byte f", append([]byte{0, 1, 2}, 3, 4, 5), []byte{0, 1, 2, 3, 4, 5}},
+
+ {"byte g", append([]byte{}, []byte{0}...), []byte{0}},
+ {"byte h", append([]byte{}, []byte{0, 1, 2, 3}...), []byte{0, 1, 2, 3}},
+
+ {"byte i", append([]byte{0, 1, 2}, []byte{3}...), []byte{0, 1, 2, 3}},
+ {"byte j", append([]byte{0, 1, 2}, []byte{3, 4, 5}...), []byte{0, 1, 2, 3, 4, 5}},
+
+ {"bytestr a", append([]byte{}, "0"...), []byte("0")},
+ {"bytestr b", append([]byte{}, "0123"...), []byte("0123")},
+
+ {"bytestr c", append([]byte("012"), "3"...), []byte("0123")},
+ {"bytestr d", append([]byte("012"), "345"...), []byte("012345")},
+
+ {"int16 a", append([]int16{}), []int16{}},
+ {"int16 b", append([]int16{}, 0), []int16{0}},
+ {"int16 c", append([]int16{}, 0, 1, 2, 3), []int16{0, 1, 2, 3}},
+
+ {"int16 d", append([]int16{0, 1, 2}), []int16{0, 1, 2}},
+ {"int16 e", append([]int16{0, 1, 2}, 3), []int16{0, 1, 2, 3}},
+ {"int16 f", append([]int16{0, 1, 2}, 3, 4, 5), []int16{0, 1, 2, 3, 4, 5}},
+
+ {"int16 g", append([]int16{}, []int16{0}...), []int16{0}},
+ {"int16 h", append([]int16{}, []int16{0, 1, 2, 3}...), []int16{0, 1, 2, 3}},
+
+ {"int16 i", append([]int16{0, 1, 2}, []int16{3}...), []int16{0, 1, 2, 3}},
+ {"int16 j", append([]int16{0, 1, 2}, []int16{3, 4, 5}...), []int16{0, 1, 2, 3, 4, 5}},
+
+
+ {"uint32 a", append([]uint32{}), []uint32{}},
+ {"uint32 b", append([]uint32{}, 0), []uint32{0}},
+ {"uint32 c", append([]uint32{}, 0, 1, 2, 3), []uint32{0, 1, 2, 3}},
+
+ {"uint32 d", append([]uint32{0, 1, 2}), []uint32{0, 1, 2}},
+ {"uint32 e", append([]uint32{0, 1, 2}, 3), []uint32{0, 1, 2, 3}},
+ {"uint32 f", append([]uint32{0, 1, 2}, 3, 4, 5), []uint32{0, 1, 2, 3, 4, 5}},
+
+ {"uint32 g", append([]uint32{}, []uint32{0}...), []uint32{0}},
+ {"uint32 h", append([]uint32{}, []uint32{0, 1, 2, 3}...), []uint32{0, 1, 2, 3}},
+
+ {"uint32 i", append([]uint32{0, 1, 2}, []uint32{3}...), []uint32{0, 1, 2, 3}},
+ {"uint32 j", append([]uint32{0, 1, 2}, []uint32{3, 4, 5}...), []uint32{0, 1, 2, 3, 4, 5}},
+
+
+ {"float64 a", append([]float64{}), []float64{}},
+ {"float64 b", append([]float64{}, 0), []float64{0}},
+ {"float64 c", append([]float64{}, 0, 1, 2, 3), []float64{0, 1, 2, 3}},
+
+ {"float64 d", append([]float64{0, 1, 2}), []float64{0, 1, 2}},
+ {"float64 e", append([]float64{0, 1, 2}, 3), []float64{0, 1, 2, 3}},
+ {"float64 f", append([]float64{0, 1, 2}, 3, 4, 5), []float64{0, 1, 2, 3, 4, 5}},
+
+ {"float64 g", append([]float64{}, []float64{0}...), []float64{0}},
+ {"float64 h", append([]float64{}, []float64{0, 1, 2, 3}...), []float64{0, 1, 2, 3}},
+
+ {"float64 i", append([]float64{0, 1, 2}, []float64{3}...), []float64{0, 1, 2, 3}},
+ {"float64 j", append([]float64{0, 1, 2}, []float64{3, 4, 5}...), []float64{0, 1, 2, 3, 4, 5}},
+
+
+ {"complex128 a", append([]complex128{}), []complex128{}},
+ {"complex128 b", append([]complex128{}, 0), []complex128{0}},
+ {"complex128 c", append([]complex128{}, 0, 1, 2, 3), []complex128{0, 1, 2, 3}},
+
+ {"complex128 d", append([]complex128{0, 1, 2}), []complex128{0, 1, 2}},
+ {"complex128 e", append([]complex128{0, 1, 2}, 3), []complex128{0, 1, 2, 3}},
+ {"complex128 f", append([]complex128{0, 1, 2}, 3, 4, 5), []complex128{0, 1, 2, 3, 4, 5}},
+
+ {"complex128 g", append([]complex128{}, []complex128{0}...), []complex128{0}},
+ {"complex128 h", append([]complex128{}, []complex128{0, 1, 2, 3}...), []complex128{0, 1, 2, 3}},
+
+ {"complex128 i", append([]complex128{0, 1, 2}, []complex128{3}...), []complex128{0, 1, 2, 3}},
+ {"complex128 j", append([]complex128{0, 1, 2}, []complex128{3, 4, 5}...), []complex128{0, 1, 2, 3, 4, 5}},
+
+
+ {"string a", append([]string{}), []string{}},
+ {"string b", append([]string{}, "0"), []string{"0"}},
+ {"string c", append([]string{}, "0", "1", "2", "3"), []string{"0", "1", "2", "3"}},
+
+ {"string d", append([]string{"0", "1", "2"}), []string{"0", "1", "2"}},
+ {"string e", append([]string{"0", "1", "2"}, "3"), []string{"0", "1", "2", "3"}},
+ {"string f", append([]string{"0", "1", "2"}, "3", "4", "5"), []string{"0", "1", "2", "3", "4", "5"}},
+
+ {"string g", append([]string{}, []string{"0"}...), []string{"0"}},
+ {"string h", append([]string{}, []string{"0", "1", "2", "3"}...), []string{"0", "1", "2", "3"}},
+
+ {"string i", append([]string{"0", "1", "2"}, []string{"3"}...), []string{"0", "1", "2", "3"}},
+ {"string j", append([]string{"0", "1", "2"}, []string{"3", "4", "5"}...), []string{"0", "1", "2", "3", "4", "5"}},
+}
+
+
+func verifyStruct() {
+ type T struct {
+ a, b, c string
+ }
+ type S []T
+ e := make(S, 100)
+ for i := range e {
+ e[i] = T{"foo", fmt.Sprintf("%d", i), "bar"}
+ }
+
+ verify("struct a", append(S{}), S{})
+ verify("struct b", append(S{}, e[0]), e[0:1])
+ verify("struct c", append(S{}, e[0], e[1], e[2]), e[0:3])
+
+ verify("struct d", append(e[0:1]), e[0:1])
+ verify("struct e", append(e[0:1], e[1]), e[0:2])
+ verify("struct f", append(e[0:1], e[1], e[2], e[3]), e[0:4])
+
+ verify("struct g", append(e[0:3]), e[0:3])
+ verify("struct h", append(e[0:3], e[3]), e[0:4])
+ verify("struct i", append(e[0:3], e[3], e[4], e[5], e[6]), e[0:7])
+
+ for i := range e {
+ verify("struct j", append(S{}, e[0:i]...), e[0:i])
+ input := make(S, i)
+ copy(input, e[0:i])
+ verify("struct k", append(input, e[i:]...), e)
+ verify("struct k - input modified", input, e[0:i])
+ }
+
+ s := make(S, 10, 20)
+ r := make(S, len(s)+len(e))
+ for i, x := range e {
+ r[len(s)+i] = x
+ }
+ verify("struct l", append(s), s)
+ verify("struct m", append(s, e...), r)
+}
+
+
+func verifyInterface() {
+ type T interface{}
+ type S []T
+ e := make(S, 100)
+ for i := range e {
+ switch i % 4 {
+ case 0:
+ e[i] = i
+ case 1:
+ e[i] = "foo"
+ case 2:
+ e[i] = fmt.Sprintf("%d", i)
+ case 3:
+ e[i] = float64(i)
+ }
+ }
+
+ verify("interface a", append(S{}), S{})
+ verify("interface b", append(S{}, e[0]), e[0:1])
+ verify("interface c", append(S{}, e[0], e[1], e[2]), e[0:3])
+
+ verify("interface d", append(e[0:1]), e[0:1])
+ verify("interface e", append(e[0:1], e[1]), e[0:2])
+ verify("interface f", append(e[0:1], e[1], e[2], e[3]), e[0:4])
+
+ verify("interface g", append(e[0:3]), e[0:3])
+ verify("interface h", append(e[0:3], e[3]), e[0:4])
+ verify("interface i", append(e[0:3], e[3], e[4], e[5], e[6]), e[0:7])
+
+ for i := range e {
+ verify("interface j", append(S{}, e[0:i]...), e[0:i])
+ input := make(S, i)
+ copy(input, e[0:i])
+ verify("interface k", append(input, e[i:]...), e)
+ verify("interface k - input modified", input, e[0:i])
+ }
+
+ s := make(S, 10, 20)
+ r := make(S, len(s)+len(e))
+ for i, x := range e {
+ r[len(s)+i] = x
+ }
+ verify("interface l", append(s), s)
+ verify("interface m", append(s, e...), r)
+}
+
+type T1 []int
+type T2 []int
+
+func verifyType() {
+ // The second argument to append has type []E where E is the
+ // element type of the first argument. Test that the compiler
+ // accepts two slice types that meet that requirement but are
+ // not assignment compatible. The return type of append is
+ // the type of the first argument.
+ t1 := T1{1}
+ t2 := T2{2}
+ verify("T1", append(t1, t2...), T1{1, 2})
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/args.go b/gcc-4.9/gcc/testsuite/go.test/test/args.go
new file mode 100644
index 0000000..0ffe810
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/args.go
@@ -0,0 +1,23 @@
+// run arg1 arg2
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test os.Args.
+
+package main
+
+import "os"
+
+func main() {
+ if len(os.Args) != 3 {
+ panic("argc")
+ }
+ if os.Args[1] != "arg1" {
+ panic("arg1")
+ }
+ if os.Args[2] != "arg2" {
+ panic("arg2")
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/assign.go b/gcc-4.9/gcc/testsuite/go.test/test/assign.go
new file mode 100644
index 0000000..da0192f
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/assign.go
@@ -0,0 +1,56 @@
+// errorcheck
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify simple assignment errors are caught by the compiler.
+// Does not compile.
+
+package main
+
+import "sync"
+
+type T struct {
+ int
+ sync.Mutex
+}
+
+func main() {
+ {
+ var x, y sync.Mutex
+ x = y // ok
+ _ = x
+ }
+ {
+ var x, y T
+ x = y // ok
+ _ = x
+ }
+ {
+ var x, y [2]sync.Mutex
+ x = y // ok
+ _ = x
+ }
+ {
+ var x, y [2]T
+ x = y // ok
+ _ = x
+ }
+ {
+ x := sync.Mutex{0, 0} // ERROR "assignment.*Mutex"
+ _ = x
+ }
+ {
+ x := sync.Mutex{key: 0} // ERROR "(unknown|assignment).*Mutex"
+ _ = x
+ }
+ {
+ x := &sync.Mutex{} // ok
+ var y sync.Mutex // ok
+ y = *x // ok
+ *x = y // ok
+ _ = x
+ _ = y
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/assign1.go b/gcc-4.9/gcc/testsuite/go.test/test/assign1.go
new file mode 100644
index 0000000..b9e0325
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/assign1.go
@@ -0,0 +1,346 @@
+// errorcheck
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify assignment rules are enforced by the compiler.
+// Does not compile.
+
+package main
+
+type (
+ A [10]int
+ B []int
+ C chan int
+ F func() int
+ I interface {
+ m() int
+ }
+ M map[int]int
+ P *int
+ S struct {
+ X int
+ }
+
+ A1 [10]int
+ B1 []int
+ C1 chan int
+ F1 func() int
+ I1 interface {
+ m() int
+ }
+ M1 map[int]int
+ P1 *int
+ S1 struct {
+ X int
+ }
+)
+
+var (
+ a0 [10]int
+ b0 []int
+ c0 chan int
+ f0 func() int
+ i0 interface {
+ m() int
+ }
+ m0 map[int]int
+ p0 *int
+ s0 struct {
+ X int
+ }
+
+ a A
+ b B
+ c C
+ f F
+ i I
+ m M
+ p P
+ s S
+
+ a1 A1
+ b1 B1
+ c1 C1
+ f1 F1
+ i1 I1
+ m1 M1
+ p1 P1
+ s1 S1
+
+ pa0 *[10]int
+ pb0 *[]int
+ pc0 *chan int
+ pf0 *func() int
+ pi0 *interface {
+ m() int
+ }
+ pm0 *map[int]int
+ pp0 **int
+ ps0 *struct {
+ X int
+ }
+
+ pa *A
+ pb *B
+ pc *C
+ pf *F
+ pi *I
+ pm *M
+ pp *P
+ ps *S
+
+ pa1 *A1
+ pb1 *B1
+ pc1 *C1
+ pf1 *F1
+ pi1 *I1
+ pm1 *M1
+ pp1 *P1
+ ps1 *S1
+)
+
+func main() {
+ a0 = a
+ a0 = a1
+ a = a0
+ a = a1 // ERROR "cannot use"
+ a1 = a0
+ a1 = a // ERROR "cannot use"
+
+ b0 = b
+ b0 = b1
+ b = b0
+ b = b1 // ERROR "cannot use"
+ b1 = b0
+ b1 = b // ERROR "cannot use"
+
+ c0 = c
+ c0 = c1
+ c = c0
+ c = c1 // ERROR "cannot use"
+ c1 = c0
+ c1 = c // ERROR "cannot use"
+
+ f0 = f
+ f0 = f1
+ f = f0
+ f = f1 // ERROR "cannot use"
+ f1 = f0
+ f1 = f // ERROR "cannot use"
+
+ i0 = i
+ i0 = i1
+ i = i0
+ i = i1
+ i1 = i0
+ i1 = i
+
+ m0 = m
+ m0 = m1
+ m = m0
+ m = m1 // ERROR "cannot use"
+ m1 = m0
+ m1 = m // ERROR "cannot use"
+
+ p0 = p
+ p0 = p1
+ p = p0
+ p = p1 // ERROR "cannot use"
+ p1 = p0
+ p1 = p // ERROR "cannot use"
+
+ s0 = s
+ s0 = s1
+ s = s0
+ s = s1 // ERROR "cannot use"
+ s1 = s0
+ s1 = s // ERROR "cannot use"
+
+ pa0 = pa // ERROR "cannot use|incompatible"
+ pa0 = pa1 // ERROR "cannot use|incompatible"
+ pa = pa0 // ERROR "cannot use|incompatible"
+ pa = pa1 // ERROR "cannot use|incompatible"
+ pa1 = pa0 // ERROR "cannot use|incompatible"
+ pa1 = pa // ERROR "cannot use|incompatible"
+
+ pb0 = pb // ERROR "cannot use|incompatible"
+ pb0 = pb1 // ERROR "cannot use|incompatible"
+ pb = pb0 // ERROR "cannot use|incompatible"
+ pb = pb1 // ERROR "cannot use|incompatible"
+ pb1 = pb0 // ERROR "cannot use|incompatible"
+ pb1 = pb // ERROR "cannot use|incompatible"
+
+ pc0 = pc // ERROR "cannot use|incompatible"
+ pc0 = pc1 // ERROR "cannot use|incompatible"
+ pc = pc0 // ERROR "cannot use|incompatible"
+ pc = pc1 // ERROR "cannot use|incompatible"
+ pc1 = pc0 // ERROR "cannot use|incompatible"
+ pc1 = pc // ERROR "cannot use|incompatible"
+
+ pf0 = pf // ERROR "cannot use|incompatible"
+ pf0 = pf1 // ERROR "cannot use|incompatible"
+ pf = pf0 // ERROR "cannot use|incompatible"
+ pf = pf1 // ERROR "cannot use|incompatible"
+ pf1 = pf0 // ERROR "cannot use|incompatible"
+ pf1 = pf // ERROR "cannot use|incompatible"
+
+ pi0 = pi // ERROR "cannot use|incompatible"
+ pi0 = pi1 // ERROR "cannot use|incompatible"
+ pi = pi0 // ERROR "cannot use|incompatible"
+ pi = pi1 // ERROR "cannot use|incompatible"
+ pi1 = pi0 // ERROR "cannot use|incompatible"
+ pi1 = pi // ERROR "cannot use|incompatible"
+
+ pm0 = pm // ERROR "cannot use|incompatible"
+ pm0 = pm1 // ERROR "cannot use|incompatible"
+ pm = pm0 // ERROR "cannot use|incompatible"
+ pm = pm1 // ERROR "cannot use|incompatible"
+ pm1 = pm0 // ERROR "cannot use|incompatible"
+ pm1 = pm // ERROR "cannot use|incompatible"
+
+ pp0 = pp // ERROR "cannot use|incompatible"
+ pp0 = pp1 // ERROR "cannot use|incompatible"
+ pp = pp0 // ERROR "cannot use|incompatible"
+ pp = pp1 // ERROR "cannot use|incompatible"
+ pp1 = pp0 // ERROR "cannot use|incompatible"
+ pp1 = pp // ERROR "cannot use|incompatible"
+
+ ps0 = ps // ERROR "cannot use|incompatible"
+ ps0 = ps1 // ERROR "cannot use|incompatible"
+ ps = ps0 // ERROR "cannot use|incompatible"
+ ps = ps1 // ERROR "cannot use|incompatible"
+ ps1 = ps0 // ERROR "cannot use|incompatible"
+ ps1 = ps // ERROR "cannot use|incompatible"
+
+
+ a0 = [10]int(a)
+ a0 = [10]int(a1)
+ a = A(a0)
+ a = A(a1)
+ a1 = A1(a0)
+ a1 = A1(a)
+
+ b0 = []int(b)
+ b0 = []int(b1)
+ b = B(b0)
+ b = B(b1)
+ b1 = B1(b0)
+ b1 = B1(b)
+
+ c0 = chan int(c)
+ c0 = chan int(c1)
+ c = C(c0)
+ c = C(c1)
+ c1 = C1(c0)
+ c1 = C1(c)
+
+ f0 = func() int(f)
+ f0 = func() int(f1)
+ f = F(f0)
+ f = F(f1)
+ f1 = F1(f0)
+ f1 = F1(f)
+
+ i0 = interface {
+ m() int
+ }(i)
+ i0 = interface {
+ m() int
+ }(i1)
+ i = I(i0)
+ i = I(i1)
+ i1 = I1(i0)
+ i1 = I1(i)
+
+ m0 = map[int]int(m)
+ m0 = map[int]int(m1)
+ m = M(m0)
+ m = M(m1)
+ m1 = M1(m0)
+ m1 = M1(m)
+
+ p0 = (*int)(p)
+ p0 = (*int)(p1)
+ p = P(p0)
+ p = P(p1)
+ p1 = P1(p0)
+ p1 = P1(p)
+
+ s0 = struct {
+ X int
+ }(s)
+ s0 = struct {
+ X int
+ }(s1)
+ s = S(s0)
+ s = S(s1)
+ s1 = S1(s0)
+ s1 = S1(s)
+
+ pa0 = (*[10]int)(pa)
+ pa0 = (*[10]int)(pa1)
+ pa = (*A)(pa0)
+ pa = (*A)(pa1)
+ pa1 = (*A1)(pa0)
+ pa1 = (*A1)(pa)
+
+ pb0 = (*[]int)(pb)
+ pb0 = (*[]int)(pb1)
+ pb = (*B)(pb0)
+ pb = (*B)(pb1)
+ pb1 = (*B1)(pb0)
+ pb1 = (*B1)(pb)
+
+ pc0 = (*chan int)(pc)
+ pc0 = (*chan int)(pc1)
+ pc = (*C)(pc0)
+ pc = (*C)(pc1)
+ pc1 = (*C1)(pc0)
+ pc1 = (*C1)(pc)
+
+ pf0 = (*func() int)(pf)
+ pf0 = (*func() int)(pf1)
+ pf = (*F)(pf0)
+ pf = (*F)(pf1)
+ pf1 = (*F1)(pf0)
+ pf1 = (*F1)(pf)
+
+ pi0 = (*interface {
+ m() int
+ })(pi)
+ pi0 = (*interface {
+ m() int
+ })(pi1)
+ pi = (*I)(pi0)
+ pi = (*I)(pi1)
+ pi1 = (*I1)(pi0)
+ pi1 = (*I1)(pi)
+
+ pm0 = (*map[int]int)(pm)
+ pm0 = (*map[int]int)(pm1)
+ pm = (*M)(pm0)
+ pm = (*M)(pm1)
+ pm1 = (*M1)(pm0)
+ pm1 = (*M1)(pm)
+
+ pp0 = (**int)(pp)
+ pp0 = (**int)(pp1)
+ pp = (*P)(pp0)
+ pp = (*P)(pp1)
+ pp1 = (*P1)(pp0)
+ pp1 = (*P1)(pp)
+
+ ps0 = (*struct {
+ X int
+ })(ps)
+ ps0 = (*struct {
+ X int
+ })(ps1)
+ ps = (*S)(ps0)
+ ps = (*S)(ps1)
+ ps1 = (*S1)(ps0)
+ ps1 = (*S1)(ps)
+
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/Makefile b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/Makefile
new file mode 100644
index 0000000..9883845
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/Makefile
@@ -0,0 +1,23 @@
+# Copyright 2010 The Go Authors. All rights reserved.
+# Use of this source code is governed by a BSD-style
+# license that can be found in the LICENSE file.
+
+ALL=\
+ parser\
+ peano\
+ tree\
+ tree2\
+
+all: $(ALL)
+
+%: %.go
+ go build $*.go stats.go
+
+%.bench: %
+ time ./$*
+
+bench: $(addsuffix .bench, $(ALL))
+
+clean:
+ rm -f $(ALL)
+
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/parser.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/parser.go
new file mode 100644
index 0000000..d85110b
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/parser.go
@@ -0,0 +1,280 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Garbage collection benchmark: parse Go packages repeatedly.
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "go/ast"
+ "go/parser"
+ "go/token"
+ "log"
+ "net/http"
+ _ "net/http/pprof"
+ "os"
+ "path"
+ "runtime"
+ "strings"
+ "time"
+)
+
+var serve = flag.String("serve", "", "serve http on this address at end")
+
+func isGoFile(dir os.FileInfo) bool {
+ return !dir.IsDir() &&
+ !strings.HasPrefix(dir.Name(), ".") && // ignore .files
+ path.Ext(dir.Name()) == ".go"
+}
+
+func isPkgFile(dir os.FileInfo) bool {
+ return isGoFile(dir) &&
+ !strings.HasSuffix(dir.Name(), "_test.go") // ignore test files
+}
+
+func pkgName(filename string) string {
+ file, err := parser.ParseFile(token.NewFileSet(), filename, nil, parser.PackageClauseOnly)
+ if err != nil || file == nil {
+ return ""
+ }
+ return file.Name.Name
+}
+
+func parseDir(dirpath string) map[string]*ast.Package {
+ // the package name is the directory name within its parent
+ // (use dirname instead of path because dirname is clean; i.e. has no trailing '/')
+ _, pkgname := path.Split(dirpath)
+
+ // filter function to select the desired .go files
+ filter := func(d os.FileInfo) bool {
+ if isPkgFile(d) {
+ // Some directories contain main packages: Only accept
+ // files that belong to the expected package so that
+ // parser.ParsePackage doesn't return "multiple packages
+ // found" errors.
+ // Additionally, accept the special package name
+ // fakePkgName if we are looking at cmd documentation.
+ name := pkgName(dirpath + "/" + d.Name())
+ return name == pkgname
+ }
+ return false
+ }
+
+ // get package AST
+ pkgs, err := parser.ParseDir(token.NewFileSet(), dirpath, filter, parser.ParseComments)
+ if err != nil {
+ println("parse", dirpath, err.Error())
+ panic("fail")
+ }
+ return pkgs
+}
+
+func main() {
+ st := new(runtime.MemStats)
+ packages = append(packages, packages...)
+ packages = append(packages, packages...)
+ n := flag.Int("n", 4, "iterations")
+ p := flag.Int("p", len(packages), "# of packages to keep in memory")
+ flag.BoolVar(&st.DebugGC, "d", st.DebugGC, "print GC debugging info (pause times)")
+ flag.Parse()
+
+ var lastParsed []map[string]*ast.Package
+ var t0 time.Time
+ var numGC uint32
+ var pauseTotalNs uint64
+ pkgroot := runtime.GOROOT() + "/src/pkg/"
+ for pass := 0; pass < 2; pass++ {
+ // Once the heap is grown to full size, reset counters.
+ // This hides the start-up pauses, which are much smaller
+ // than the normal pauses and would otherwise make
+ // the average look much better than it actually is.
+ runtime.ReadMemStats(st)
+ numGC = st.NumGC
+ pauseTotalNs = st.PauseTotalNs
+ t0 = time.Now()
+
+ for i := 0; i < *n; i++ {
+ parsed := make([]map[string]*ast.Package, *p)
+ for j := range parsed {
+ parsed[j] = parseDir(pkgroot + packages[j%len(packages)])
+ }
+ if i+1 == *n && *serve != "" {
+ lastParsed = parsed
+ }
+ }
+ runtime.GC()
+ runtime.GC()
+ }
+ t1 := time.Now()
+
+ runtime.ReadMemStats(st)
+ st.NumGC -= numGC
+ st.PauseTotalNs -= pauseTotalNs
+ fmt.Printf("Alloc=%d/%d Heap=%d Mallocs=%d PauseTime=%.3f/%d = %.3f\n",
+ st.Alloc, st.TotalAlloc,
+ st.Sys,
+ st.Mallocs, float64(st.PauseTotalNs)/1e9,
+ st.NumGC, float64(st.PauseTotalNs)/1e9/float64(st.NumGC))
+
+ /*
+ fmt.Printf("%10s %10s %10s\n", "size", "#alloc", "#free")
+ for _, s := range st.BySize {
+ fmt.Printf("%10d %10d %10d\n", s.Size, s.Mallocs, s.Frees)
+ }
+ */
+ // Standard gotest benchmark output, collected by build dashboard.
+ gcstats("BenchmarkParser", *n, t1.Sub(t0))
+
+ if *serve != "" {
+ log.Fatal(http.ListenAndServe(*serve, nil))
+ println(lastParsed)
+ }
+}
+
+// find . -type d -not -path "./exp" -not -path "./exp/*" -printf "\t\"%p\",\n" | sort | sed "s/\.\///" | grep -v testdata
+var packages = []string{
+ "archive",
+ "archive/tar",
+ "archive/zip",
+ "bufio",
+ "builtin",
+ "bytes",
+ "compress",
+ "compress/bzip2",
+ "compress/flate",
+ "compress/gzip",
+ "compress/lzw",
+ "compress/zlib",
+ "container",
+ "container/heap",
+ "container/list",
+ "container/ring",
+ "crypto",
+ "crypto/aes",
+ "crypto/cipher",
+ "crypto/des",
+ "crypto/dsa",
+ "crypto/ecdsa",
+ "crypto/elliptic",
+ "crypto/hmac",
+ "crypto/md5",
+ "crypto/rand",
+ "crypto/rc4",
+ "crypto/rsa",
+ "crypto/sha1",
+ "crypto/sha256",
+ "crypto/sha512",
+ "crypto/subtle",
+ "crypto/tls",
+ "crypto/x509",
+ "crypto/x509/pkix",
+ "database",
+ "database/sql",
+ "database/sql/driver",
+ "debug",
+ "debug/dwarf",
+ "debug/elf",
+ "debug/gosym",
+ "debug/macho",
+ "debug/pe",
+ "encoding",
+ "encoding/ascii85",
+ "encoding/asn1",
+ "encoding/base32",
+ "encoding/base64",
+ "encoding/binary",
+ "encoding/csv",
+ "encoding/gob",
+ "encoding/hex",
+ "encoding/json",
+ "encoding/pem",
+ "encoding/xml",
+ "errors",
+ "expvar",
+ "flag",
+ "fmt",
+ "go",
+ "go/ast",
+ "go/build",
+ "go/doc",
+ "go/format",
+ "go/parser",
+ "go/printer",
+ "go/scanner",
+ "go/token",
+ "hash",
+ "hash/adler32",
+ "hash/crc32",
+ "hash/crc64",
+ "hash/fnv",
+ "html",
+ "html/template",
+ "image",
+ "image/color",
+ "image/draw",
+ "image/gif",
+ "image/jpeg",
+ "image/png",
+ "index",
+ "index/suffixarray",
+ "io",
+ "io/ioutil",
+ "log",
+ "log/syslog",
+ "math",
+ "math/big",
+ "math/cmplx",
+ "math/rand",
+ "mime",
+ "mime/multipart",
+ "net",
+ "net/http",
+ "net/http/cgi",
+ "net/http/cookiejar",
+ "net/http/fcgi",
+ "net/http/httptest",
+ "net/http/httputil",
+ "net/http/pprof",
+ "net/mail",
+ "net/rpc",
+ "net/rpc/jsonrpc",
+ "net/smtp",
+ "net/textproto",
+ "net/url",
+ "os",
+ "os/exec",
+ "os/signal",
+ "os/user",
+ "path",
+ "path/filepath",
+ "reflect",
+ "regexp",
+ "regexp/syntax",
+ "runtime",
+ "runtime/cgo",
+ "runtime/debug",
+ "runtime/pprof",
+ "runtime/race",
+ "sort",
+ "strconv",
+ "strings",
+ "sync",
+ "sync/atomic",
+ "syscall",
+ "testing",
+ "testing/iotest",
+ "testing/quick",
+ "text",
+ "text/scanner",
+ "text/tabwriter",
+ "text/template",
+ "text/template/parse",
+ "time",
+ "unicode",
+ "unicode/utf16",
+ "unicode/utf8",
+ "unsafe",
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/peano.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/peano.go
new file mode 100644
index 0000000..6c7e523
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/peano.go
@@ -0,0 +1,121 @@
+// run
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+import (
+ "fmt"
+ "runtime"
+ "time"
+)
+
+type Number struct {
+ next *Number
+}
+
+// -------------------------------------
+// Peano primitives
+
+func zero() *Number { return nil }
+
+func is_zero(x *Number) bool { return x == nil }
+
+func add1(x *Number) *Number {
+ e := new(Number)
+ e.next = x
+ return e
+}
+
+func sub1(x *Number) *Number { return x.next }
+
+func add(x, y *Number) *Number {
+ if is_zero(y) {
+ return x
+ }
+
+ return add(add1(x), sub1(y))
+}
+
+func mul(x, y *Number) *Number {
+ if is_zero(x) || is_zero(y) {
+ return zero()
+ }
+
+ return add(mul(x, sub1(y)), x)
+}
+
+func fact(n *Number) *Number {
+ if is_zero(n) {
+ return add1(zero())
+ }
+
+ return mul(fact(sub1(n)), n)
+}
+
+// -------------------------------------
+// Helpers to generate/count Peano integers
+
+func gen(n int) *Number {
+ if n > 0 {
+ return add1(gen(n - 1))
+ }
+
+ return zero()
+}
+
+func count(x *Number) int {
+ if is_zero(x) {
+ return 0
+ }
+
+ return count(sub1(x)) + 1
+}
+
+func check(x *Number, expected int) {
+ var c = count(x)
+ if c != expected {
+ panic(fmt.Sprintf("error: found %d; expected %d", c, expected))
+ }
+}
+
+// -------------------------------------
+// Test basic functionality
+
+func verify() {
+ check(zero(), 0)
+ check(add1(zero()), 1)
+ check(gen(10), 10)
+
+ check(add(gen(3), zero()), 3)
+ check(add(zero(), gen(4)), 4)
+ check(add(gen(3), gen(4)), 7)
+
+ check(mul(zero(), zero()), 0)
+ check(mul(gen(3), zero()), 0)
+ check(mul(zero(), gen(4)), 0)
+ check(mul(gen(3), add1(zero())), 3)
+ check(mul(add1(zero()), gen(4)), 4)
+ check(mul(gen(3), gen(4)), 12)
+
+ check(fact(zero()), 1)
+ check(fact(add1(zero())), 1)
+ check(fact(gen(5)), 120)
+}
+
+// -------------------------------------
+// Factorial
+
+func main() {
+ t0 := time.Now()
+ verify()
+ for i := 0; i <= 9; i++ {
+ print(i, "! = ", count(fact(gen(i))), "\n")
+ }
+ runtime.GC()
+ t1 := time.Now()
+
+ gcstats("BenchmarkPeano", 1, t1.Sub(t0))
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/stats.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/stats.go
new file mode 100644
index 0000000..6dc0aeb
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/stats.go
@@ -0,0 +1,52 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+import (
+ "fmt"
+ "runtime"
+ "sort"
+ "time"
+)
+
+func gcstats(name string, n int, t time.Duration) {
+ st := new(runtime.MemStats)
+ runtime.ReadMemStats(st)
+ nprocs := runtime.GOMAXPROCS(-1)
+ cpus := ""
+ if nprocs != 1 {
+ cpus = fmt.Sprintf("-%d", nprocs)
+ }
+ fmt.Printf("garbage.%sMem%s Alloc=%d/%d Heap=%d NextGC=%d Mallocs=%d\n", name, cpus, st.Alloc, st.TotalAlloc, st.Sys, st.NextGC, st.Mallocs)
+ fmt.Printf("garbage.%s%s %d %d ns/op\n", name, cpus, n, t.Nanoseconds()/int64(n))
+ fmt.Printf("garbage.%sLastPause%s 1 %d ns/op\n", name, cpus, st.PauseNs[(st.NumGC-1)%uint32(len(st.PauseNs))])
+ fmt.Printf("garbage.%sPause%s %d %d ns/op\n", name, cpus, st.NumGC, int64(st.PauseTotalNs)/int64(st.NumGC))
+ nn := int(st.NumGC)
+ if nn >= len(st.PauseNs) {
+ nn = len(st.PauseNs)
+ }
+ t1, t2, t3, t4, t5 := tukey5(st.PauseNs[0:nn])
+ fmt.Printf("garbage.%sPause5%s: %d %d %d %d %d\n", name, cpus, t1, t2, t3, t4, t5)
+
+ // fmt.Printf("garbage.%sScan: %v\n", name, st.ScanDist)
+}
+
+type T []uint64
+
+func (t T) Len() int { return len(t) }
+func (t T) Swap(i, j int) { t[i], t[j] = t[j], t[i] }
+func (t T) Less(i, j int) bool { return t[i] < t[j] }
+
+func tukey5(raw []uint64) (lo, q1, q2, q3, hi uint64) {
+ x := make(T, len(raw))
+ copy(x, raw)
+ sort.Sort(T(x))
+ lo = x[0]
+ q1 = x[len(x)/4]
+ q2 = x[len(x)/2]
+ q3 = x[len(x)*3/4]
+ hi = x[len(x)-1]
+ return
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree.go
new file mode 100644
index 0000000..0a3ec23
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree.go
@@ -0,0 +1,100 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ *
+ * contributed by The Go Authors.
+ * based on C program by Kevin Carson
+ */
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "time"
+)
+
+var n = flag.Int("n", 16, "depth")
+
+type Node struct {
+ item int
+ left, right *Node
+}
+
+func bottomUpTree(item, depth int) *Node {
+ if depth <= 0 {
+ return &Node{item: item}
+ }
+ return &Node{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
+}
+
+func (n *Node) itemCheck() int {
+ if n.left == nil {
+ return n.item
+ }
+ return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func main() {
+ flag.Parse()
+
+ t0 := time.Now()
+
+ maxDepth := *n
+ if minDepth+2 > *n {
+ maxDepth = minDepth + 2
+ }
+ stretchDepth := maxDepth + 1
+
+ check := bottomUpTree(0, stretchDepth).itemCheck()
+ fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+ longLivedTree := bottomUpTree(0, maxDepth)
+
+ for depth := minDepth; depth <= maxDepth; depth += 2 {
+ iterations := 1 << uint(maxDepth-depth+minDepth)
+ check = 0
+
+ for i := 1; i <= iterations; i++ {
+ check += bottomUpTree(i, depth).itemCheck()
+ check += bottomUpTree(-i, depth).itemCheck()
+ }
+ fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+ }
+ fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+
+ t1 := time.Now()
+
+ // Standard gotest benchmark output, collected by build dashboard.
+ gcstats("BenchmarkTree", *n, t1.Sub(t0))
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree2.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree2.go
new file mode 100644
index 0000000..a171c69
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/garbage/tree2.go
@@ -0,0 +1,95 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "log"
+ "os"
+ "runtime"
+ "runtime/pprof"
+ "time"
+ "unsafe"
+)
+
+const BranchingFactor = 4
+
+type Object struct {
+ child [BranchingFactor]*Object
+}
+
+var (
+ cpus = flag.Int("cpus", 1, "number of cpus to use")
+ heapsize = flag.Int64("heapsize", 100*1024*1024, "size of the heap in bytes")
+ cpuprofile = flag.String("cpuprofile", "", "write cpu profile to file")
+
+ lastPauseNs uint64 = 0
+ lastFree uint64 = 0
+ heap *Object
+ calls [20]int
+ numobjects int64
+ memstats runtime.MemStats
+)
+
+func buildHeap() {
+ objsize := int64(unsafe.Sizeof(Object{}))
+ heap, _ = buildTree(float64(objsize), float64(*heapsize), 0)
+ fmt.Printf("*** built heap: %.0f MB; (%d objects * %d bytes)\n",
+ float64(*heapsize)/1048576, numobjects, objsize)
+}
+
+func buildTree(objsize, size float64, depth int) (*Object, float64) {
+ calls[depth]++
+ x := &Object{}
+ numobjects++
+ subtreeSize := (size - objsize) / BranchingFactor
+ alloc := objsize
+ for i := 0; i < BranchingFactor && alloc < size; i++ {
+ c, n := buildTree(objsize, subtreeSize, depth+1)
+ x.child[i] = c
+ alloc += n
+ }
+ return x, alloc
+}
+
+func gc() {
+ runtime.GC()
+ runtime.ReadMemStats(&memstats)
+ pause := memstats.PauseTotalNs
+ inuse := memstats.Alloc
+ free := memstats.TotalAlloc - inuse
+ fmt.Printf("gc pause: %8.3f ms; collect: %8.0f MB; heapsize: %8.0f MB\n",
+ float64(pause-lastPauseNs)/1e6,
+ float64(free-lastFree)/1048576,
+ float64(inuse)/1048576)
+ lastPauseNs = pause
+ lastFree = free
+}
+
+func main() {
+ flag.Parse()
+ buildHeap()
+ runtime.GOMAXPROCS(*cpus)
+ runtime.ReadMemStats(&memstats)
+ lastPauseNs = memstats.PauseTotalNs
+ lastFree = memstats.TotalAlloc - memstats.Alloc
+ if *cpuprofile != "" {
+ f, err := os.Create(*cpuprofile)
+ if err != nil {
+ log.Fatal(err)
+ }
+ pprof.StartCPUProfile(f)
+ defer pprof.StopCPUProfile()
+ }
+ const N = 10
+ var t0 time.Time
+ for i := 0; i < N; i++ {
+ t0 = time.Now()
+ gc()
+ }
+ // Standard gotest benchmark output, collected by build dashboard.
+ gcstats("BenchmarkTree2", N, time.Now().Sub(t0))
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go
new file mode 100644
index 0000000..c64c4b8
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/binarytree_test.go
@@ -0,0 +1,63 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests garbage collector
+// performance by generating and discarding large binary trees.
+
+package go1
+
+import "testing"
+
+type binaryNode struct {
+ item int
+ left, right *binaryNode
+}
+
+func bottomUpTree(item, depth int) *binaryNode {
+ if depth <= 0 {
+ return &binaryNode{item: item}
+ }
+ return &binaryNode{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
+}
+
+func (n *binaryNode) itemCheck() int {
+ if n.left == nil {
+ return n.item
+ }
+ return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func binarytree(n int) {
+ maxDepth := n
+ if minDepth+2 > n {
+ maxDepth = minDepth + 2
+ }
+ stretchDepth := maxDepth + 1
+
+ check := bottomUpTree(0, stretchDepth).itemCheck()
+ //fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+ longLivedTree := bottomUpTree(0, maxDepth)
+
+ for depth := minDepth; depth <= maxDepth; depth += 2 {
+ iterations := 1 << uint(maxDepth-depth+minDepth)
+ check = 0
+
+ for i := 1; i <= iterations; i++ {
+ check += bottomUpTree(i, depth).itemCheck()
+ check += bottomUpTree(-i, depth).itemCheck()
+ }
+ //fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+ }
+ longLivedTree.itemCheck()
+ //fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+}
+
+func BenchmarkBinaryTree17(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ binarytree(17)
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go
new file mode 100644
index 0000000..ae45bfd
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fannkuch_test.go
@@ -0,0 +1,84 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests array indexing
+// and array bounds elimination performance.
+
+package go1
+
+import "testing"
+
+func fannkuch(n int) int {
+ if n < 1 {
+ return 0
+ }
+
+ n1 := n - 1
+ perm := make([]int, n)
+ perm1 := make([]int, n)
+ count := make([]int, n)
+
+ for i := 0; i < n; i++ {
+ perm1[i] = i // initial (trivial) permutation
+ }
+
+ r := n
+ didpr := 0
+ flipsMax := 0
+ for {
+ if didpr < 30 {
+ didpr++
+ }
+ for ; r != 1; r-- {
+ count[r-1] = r
+ }
+
+ if perm1[0] != 0 && perm1[n1] != n1 {
+ flips := 0
+ for i := 1; i < n; i++ { // perm = perm1
+ perm[i] = perm1[i]
+ }
+ k := perm1[0] // cache perm[0] in k
+ for { // k!=0 ==> k>0
+ for i, j := 1, k-1; i < j; i, j = i+1, j-1 {
+ perm[i], perm[j] = perm[j], perm[i]
+ }
+ flips++
+ // Now exchange k (caching perm[0]) and perm[k]... with care!
+ j := perm[k]
+ perm[k] = k
+ k = j
+ if k == 0 {
+ break
+ }
+ }
+ if flipsMax < flips {
+ flipsMax = flips
+ }
+ }
+
+ for ; r < n; r++ {
+ // rotate down perm[0..r] by one
+ perm0 := perm1[0]
+ for i := 0; i < r; i++ {
+ perm1[i] = perm1[i+1]
+ }
+ perm1[r] = perm0
+ count[r]--
+ if count[r] > 0 {
+ break
+ }
+ }
+ if r == n {
+ return flipsMax
+ }
+ }
+ return 0
+}
+
+func BenchmarkFannkuch11(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ fannkuch(11)
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fasta_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fasta_test.go
new file mode 100644
index 0000000..bff056f
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fasta_test.go
@@ -0,0 +1,179 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+import "runtime"
+
+// Not a benchmark; input for revcomp.
+
+var fastabytes = makefasta()
+
+func makefasta() []byte {
+ var n int = 25e6
+ if runtime.GOARCH == "arm" {
+ // TODO(dfc) remove this limitation after precise gc.
+ // A value of 25e6 consumes 465mb of heap on 32bit
+ // platforms, which is too much for most ARM systems.
+ // A value of 25e5 produces a memory layout that
+ // confuses the gc on 32bit platforms. So 25e4 it is.
+ n = 25e4
+ }
+ return fasta(n)
+}
+
+func fasta(n int) []byte {
+ out := make(fastaBuffer, 0, 11*n)
+
+ iub := []fastaAcid{
+ {prob: 0.27, sym: 'a'},
+ {prob: 0.12, sym: 'c'},
+ {prob: 0.12, sym: 'g'},
+ {prob: 0.27, sym: 't'},
+ {prob: 0.02, sym: 'B'},
+ {prob: 0.02, sym: 'D'},
+ {prob: 0.02, sym: 'H'},
+ {prob: 0.02, sym: 'K'},
+ {prob: 0.02, sym: 'M'},
+ {prob: 0.02, sym: 'N'},
+ {prob: 0.02, sym: 'R'},
+ {prob: 0.02, sym: 'S'},
+ {prob: 0.02, sym: 'V'},
+ {prob: 0.02, sym: 'W'},
+ {prob: 0.02, sym: 'Y'},
+ }
+
+ homosapiens := []fastaAcid{
+ {prob: 0.3029549426680, sym: 'a'},
+ {prob: 0.1979883004921, sym: 'c'},
+ {prob: 0.1975473066391, sym: 'g'},
+ {prob: 0.3015094502008, sym: 't'},
+ }
+
+ alu := []byte(
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
+
+ out.WriteString(">ONE Homo sapiens alu\n")
+ fastaRepeat(&out, alu, 2*n)
+ out.WriteString(">TWO IUB ambiguity codes\n")
+ fastaRandom(&out, iub, 3*n)
+ out.WriteString(">THREE Homo sapiens frequency\n")
+ fastaRandom(&out, homosapiens, 5*n)
+ return out
+}
+
+type fastaBuffer []byte
+
+func (b *fastaBuffer) Flush() {
+ panic("flush")
+}
+
+func (b *fastaBuffer) WriteString(s string) {
+ p := b.NextWrite(len(s))
+ copy(p, s)
+}
+
+func (b *fastaBuffer) NextWrite(n int) []byte {
+ p := *b
+ if len(p)+n > cap(p) {
+ b.Flush()
+ p = *b
+ }
+ out := p[len(p) : len(p)+n]
+ *b = p[:len(p)+n]
+ return out
+}
+
+const fastaLine = 60
+
+func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
+ buf := append(alu, alu...)
+ off := 0
+ for n > 0 {
+ m := n
+ if m > fastaLine {
+ m = fastaLine
+ }
+ buf1 := out.NextWrite(m + 1)
+ copy(buf1, buf[off:])
+ buf1[m] = '\n'
+ if off += m; off >= len(alu) {
+ off -= len(alu)
+ }
+ n -= m
+ }
+}
+
+const (
+ fastaLookupSize = 4096
+ fastaLookupScale float64 = fastaLookupSize - 1
+)
+
+var fastaRand uint32 = 42
+
+type fastaAcid struct {
+ sym byte
+ prob float64
+ cprob float64
+ next *fastaAcid
+}
+
+func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
+ var lookup [fastaLookupSize]*fastaAcid
+ var p float64
+ for i := range acid {
+ p += acid[i].prob
+ acid[i].cprob = p * fastaLookupScale
+ if i > 0 {
+ acid[i-1].next = &acid[i]
+ }
+ }
+ acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
+
+ j := 0
+ for i := range lookup {
+ for acid[j].cprob < float64(i) {
+ j++
+ }
+ lookup[i] = &acid[j]
+ }
+
+ return &lookup
+}
+
+func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
+ const (
+ IM = 139968
+ IA = 3877
+ IC = 29573
+ )
+ lookup := fastaComputeLookup(acid)
+ for n > 0 {
+ m := n
+ if m > fastaLine {
+ m = fastaLine
+ }
+ buf := out.NextWrite(m + 1)
+ f := fastaLookupScale / IM
+ myrand := fastaRand
+ for i := 0; i < m; i++ {
+ myrand = (myrand*IA + IC) % IM
+ r := float64(int(myrand)) * f
+ a := lookup[int(r)]
+ for a.cprob < r {
+ a = a.next
+ }
+ buf[i] = a.sym
+ }
+ fastaRand = myrand
+ buf[m] = '\n'
+ n -= m
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fmt_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fmt_test.go
new file mode 100644
index 0000000..d3c6956
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/fmt_test.go
@@ -0,0 +1,68 @@
+// Copyright 2013 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+// benchmark based on fmt/fmt_test.go
+
+import (
+ "bytes"
+ "fmt"
+ "testing"
+)
+
+func BenchmarkFmtFprintfEmpty(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ fmt.Fprintf(&buf, "")
+ }
+}
+
+func BenchmarkFmtFprintfString(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "%s", "hello")
+ }
+}
+
+func BenchmarkFmtFprintfInt(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "%d", 5)
+ }
+}
+
+func BenchmarkFmtFprintfIntInt(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "%d %d", 5, 6)
+ }
+}
+
+func BenchmarkFmtFprintfPrefixedInt(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "This is some meaningless prefix text that needs to be scanned %d", 6)
+ }
+}
+
+func BenchmarkFmtFprintfFloat(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "%g", 5.23184)
+ }
+}
+
+func BenchmarkFmtManyArgs(b *testing.B) {
+ var buf bytes.Buffer
+ for i := 0; i < b.N; i++ {
+ buf.Reset()
+ fmt.Fprintf(&buf, "%2d/%2d/%2d %d:%d:%d %s %s\n", 3, 4, 5, 11, 12, 13, "hello", "world")
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gob_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gob_test.go
new file mode 100644
index 0000000..b172b80
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gob_test.go
@@ -0,0 +1,93 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests gob encoding and decoding performance.
+
+package go1
+
+import (
+ "bytes"
+ "encoding/gob"
+ "encoding/json"
+ "io/ioutil"
+ "log"
+ "reflect"
+ "testing"
+)
+
+var (
+ gobbytes []byte
+ gobdata *JSONResponse
+)
+
+func init() {
+ gobdata = gobResponse(&jsondata)
+
+ var buf bytes.Buffer
+ if err := gob.NewEncoder(&buf).Encode(gobdata); err != nil {
+ panic(err)
+ }
+ gobbytes = buf.Bytes()
+
+ var r JSONResponse
+ if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil {
+ panic(err)
+ }
+ if !reflect.DeepEqual(gobdata, &r) {
+ log.Printf("%v\n%v", jsondata, r)
+ b, _ := json.Marshal(&jsondata)
+ br, _ := json.Marshal(&r)
+ log.Printf("%s\n%s\n", b, br)
+ panic("gob: encode+decode lost data")
+ }
+}
+
+// gob turns [] into null, so make a copy of the data structure like that
+func gobResponse(r *JSONResponse) *JSONResponse {
+ return &JSONResponse{gobNode(r.Tree), r.Username}
+}
+
+func gobNode(n *JSONNode) *JSONNode {
+ n1 := new(JSONNode)
+ *n1 = *n
+ if len(n1.Kids) == 0 {
+ n1.Kids = nil
+ } else {
+ for i, k := range n1.Kids {
+ n1.Kids[i] = gobNode(k)
+ }
+ }
+ return n1
+}
+
+func gobdec() {
+ if gobbytes == nil {
+ panic("gobdata not initialized")
+ }
+ var r JSONResponse
+ if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil {
+ panic(err)
+ }
+ _ = r
+}
+
+func gobenc() {
+ if err := gob.NewEncoder(ioutil.Discard).Encode(&gobdata); err != nil {
+ panic(err)
+ }
+}
+
+func BenchmarkGobDecode(b *testing.B) {
+ b.SetBytes(int64(len(gobbytes)))
+ for i := 0; i < b.N; i++ {
+ gobdec()
+ }
+}
+
+func BenchmarkGobEncode(b *testing.B) {
+ b.SetBytes(int64(len(gobbytes)))
+ for i := 0; i < b.N; i++ {
+ gobenc()
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gzip_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gzip_test.go
new file mode 100644
index 0000000..fe4c480
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/gzip_test.go
@@ -0,0 +1,63 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests gzip and gunzip performance.
+
+package go1
+
+import (
+ "bytes"
+ gz "compress/gzip"
+ "io"
+ "io/ioutil"
+ "testing"
+)
+
+var (
+ jsongunz = bytes.Repeat(jsonbytes, 10)
+ jsongz []byte
+)
+
+func init() {
+ var buf bytes.Buffer
+ c := gz.NewWriter(&buf)
+ c.Write(jsongunz)
+ c.Close()
+ jsongz = buf.Bytes()
+}
+
+func gzip() {
+ c := gz.NewWriter(ioutil.Discard)
+ if _, err := c.Write(jsongunz); err != nil {
+ panic(err)
+ }
+ if err := c.Close(); err != nil {
+ panic(err)
+ }
+}
+
+func gunzip() {
+ r, err := gz.NewReader(bytes.NewBuffer(jsongz))
+ if err != nil {
+ panic(err)
+ }
+ if _, err := io.Copy(ioutil.Discard, r); err != nil {
+ panic(err)
+ }
+ r.Close()
+}
+
+func BenchmarkGzip(b *testing.B) {
+ b.SetBytes(int64(len(jsongunz)))
+ for i := 0; i < b.N; i++ {
+ gzip()
+ }
+}
+
+func BenchmarkGunzip(b *testing.B) {
+ b.SetBytes(int64(len(jsongunz)))
+ for i := 0; i < b.N; i++ {
+ gunzip()
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/http_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/http_test.go
new file mode 100644
index 0000000..34e789f
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/http_test.go
@@ -0,0 +1,45 @@
+// Copyright 2013 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+import (
+ "bytes"
+ "io/ioutil"
+ "net/http"
+ "net/http/httptest"
+ "testing"
+)
+
+// BenchmarkHTTPClientServer benchmarks both the HTTP client and the HTTP server,
+// on small requests.
+func BenchmarkHTTPClientServer(b *testing.B) {
+ msg := []byte("Hello world.\n")
+ ts := httptest.NewServer(http.HandlerFunc(func(rw http.ResponseWriter, r *http.Request) {
+ rw.Write(msg)
+ }))
+ defer ts.Close()
+
+ tr := &http.Transport{}
+ defer tr.CloseIdleConnections()
+ cl := &http.Client{
+ Transport: tr,
+ }
+
+ b.ResetTimer()
+
+ for i := 0; i < b.N; i++ {
+ res, err := cl.Get(ts.URL)
+ if err != nil {
+ b.Fatal("Get:", err)
+ }
+ all, err := ioutil.ReadAll(res.Body)
+ if err != nil {
+ b.Fatal("ReadAll:", err)
+ }
+ if !bytes.Equal(all, msg) {
+ b.Fatalf("Got body %q; want %q", all, msg)
+ }
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/json_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/json_test.go
new file mode 100644
index 0000000..1d42619
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/json_test.go
@@ -0,0 +1,87 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests JSON encoding and decoding performance.
+
+package go1
+
+import (
+ "bytes"
+ "compress/bzip2"
+ "encoding/base64"
+ "encoding/json"
+ "io"
+ "io/ioutil"
+ "testing"
+)
+
+var (
+ jsonbytes = makeJsonBytes()
+ jsondata = makeJsonData()
+)
+
+func makeJsonBytes() []byte {
+ var r io.Reader
+ r = bytes.NewReader(bytes.Replace(jsonbz2_base64, []byte{'\n'}, nil, -1))
+ r = base64.NewDecoder(base64.StdEncoding, r)
+ r = bzip2.NewReader(r)
+ b, err := ioutil.ReadAll(r)
+ if err != nil {
+ panic(err)
+ }
+ return b
+}
+
+func makeJsonData() JSONResponse {
+ var v JSONResponse
+ if err := json.Unmarshal(jsonbytes, &v); err != nil {
+ panic(err)
+ }
+ return v
+}
+
+type JSONResponse struct {
+ Tree *JSONNode `json:"tree"`
+ Username string `json:"username"`
+}
+
+type JSONNode struct {
+ Name string `json:"name"`
+ Kids []*JSONNode `json:"kids"`
+ CLWeight float64 `json:"cl_weight"`
+ Touches int `json:"touches"`
+ MinT int64 `json:"min_t"`
+ MaxT int64 `json:"max_t"`
+ MeanT int64 `json:"mean_t"`
+}
+
+func jsondec() {
+ var r JSONResponse
+ if err := json.Unmarshal(jsonbytes, &r); err != nil {
+ panic(err)
+ }
+ _ = r
+}
+
+func jsonenc() {
+ buf, err := json.Marshal(&jsondata)
+ if err != nil {
+ panic(err)
+ }
+ _ = buf
+}
+
+func BenchmarkJSONEncode(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ jsonenc()
+ }
+}
+
+func BenchmarkJSONDecode(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ jsondec()
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go
new file mode 100644
index 0000000..cf0fac1
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/jsondata_test.go
@@ -0,0 +1,1819 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Input for JSON and other benchmarks.
+// This was generated by starting with a 2MB JSON file with actual data
+// about open source revision history, then compressing with bzip2 -9,
+// then encoding to base64 with openssl enc -e -base64.
+// The result is 125kB of source instead of 2MB.
+// We compile the data into the binary so that the benchmark is
+// a stand-alone binary that can be copied easily from machine to
+// machine. json_test.go decodes this during init.
+
+package go1
+
+var jsonbz2_base64 = []byte(`
+QlpoOTFBWSZTWZ0H0LkG0bxfgFH8UAf/8D////q////6YSvJveAAAAAH3ddt7gAN
+FrKppN9gw0gA++fGB9xKkUpX0YWTENCgqzUW1tlsyMB2w9nnvNSigNyS+3cui5zA
+AAAAAAAAAI4kILu6ytuWTLBbaPXfc+A+PQEgNAG1ZMBYWnWwPoFrGjoBnYMumlUF
+UKA7NVBQgut30zzu8eM2tsoapJ7u41djLsxZarplSoJouxrdfHrHPSiqAGgkAD6D
+QfT0ABu7gG1qDtdVHVXp7vWuBoBk2wEOjKChQ5bvbh3riupXZycASbaiQEECRKib
+ZFJFtqWjR7bsGoaa1lIFPRoKVQKoJFyqbWr5OB1Aie2pobm1EJKqVBU1EE2lCg6a
+AUBV9hqL00q9btQ0J9hqu2zavWVdjI6aAusU22tNa+8m70GjRqarKRWtUDW2yFBI
+1kBrrqrxeX3AyB9AD0wAAAeZ6weqV1rVu8UVICgAAABeDn2cAAd9gAACI+7DvjHo
+j73u8X2dDXT2x6adeFOTNe7BvavozFezkV1xXtJzu8H0983QAHr5aPT42iem53fX
+23IDr7YejQNtVVZr24gGgB0VQffPXH18g9DoaDW8vt729h9bt72XsKth0ANxgodG
+iRxvYclAAAAAnpqRtgGvcbo9ABpy6aPQADRZ3aACjyox4NawKCqNdA6offa1WtPc
+fdjQUPvauprcLoPe2oaplp2w7cnOHdlF27xvPY1QU67vc8goBRttLYKaHXkPAAAA
+AAdyFFaYCVClAVSlCqVSilFUKEgoNT0CAQCBAk00g1T0jQNNPSbKADQxAJEBESIg
+Seomk9EB6mjQ0NNGgAAAAkEgkiGk0CR6U9CNNNNNPQRo0ANAaAAk9UpEQmoNNRqe
+U02o00AAADQABoACJEAlKamUCjZT9UGnqAAG1AGgAAAFRJCAQCBA0SYjTKbQmqea
+p6YU2o09Q9TT00nAlwPEuSelCeXl28B3IYIQHEwXUMSCvlAYS5LkrZn+XhHHAXZz
+FTJHAzrKZzYWC0pthA9SCmbkyVzoHbSUjhnAfBrYpwWYIB7GRjOjDQqokMbJENSO
+SBCN0WhaRhQWpVuoOLN0NPRed7eO5eW2lv5L+X/jf7EpJkEUNMJKZREogmkjMgZJ
+BiEEEliRIUKAoiaSEoDQZJBhKEZEQySQCAIIFNIMwCiSYRSYzKMkSSlI0xZMZKko
+RKlRtkmWJIrNNIBEJEYiJBhGMMkWYxRqUsmjKJMmCFJMaSmiyDSaEJtBIJpANKMN
+JEkpGQAYjLNETGUBRAlBKURgsC0wzKZhRmhiYIQZIsZCIIMiiNmFCCiSZNjI0khE
+AYSEUkjTMSZskZKRQWJoRNBI2IojZmMhTIkQEgyREEMoomDSiYxAZMECFCSKIkGg
+kIDIw2MNAlgyA0SmKWSSyIaRCSDDIkZmNGghgyAEoERokkWTA0xZBEQhmUSBGmaQ
+aQBFmRJMokwxIyRSWbAkbCUFlAhgUISJIRkySYhAxoUARCSaIJMkyiZJNBMyGRIh
+Y0komKImgMDI/038qLf/av/bWSNVEtmFRx/2aaDVmKkY0NkIRDGJEWoEGLf9g9MV
+UJWGSu0pWVpSOdWDVjQJGRSChGBGDGhNNMYYwjEsaFISGPT3TbFXk873Xq8vPa9b
+0dcco0UEPXIl/+em0IMHNYJaXBEsiKQh/7QwsC9gAauDvWtMEBWhGBIBAerIYlBU
+SzPasze15BfAyGrr284QNjGNEmaUphiMxEMwCZjAYRpMiZBMpEMkkQzIwTDu5zru
+Xd1xdQ6A6E7m7d03OLnXOxd3HBu50dl0JOhxS4HdHczuO647uuLu6650O67t3Duu
+3DucukzRKIMhsUjSQQxDIzQJgxohEkYTYkZsAxSDGCJJERhpEAygoZRESSEjMpFE
+0UpJlBkIYwoyQ7/2f9H/Py8roY3wEn8nr7+72ybZtybdqY06yp1tjGVmsmJvG48y
+89EXnvy9F6OvX0vpBSIEiSRAmgSASYSkCGBkyc5J63pgiRBNsJW2xjGmmNsf9v7R
+z1rueFmZcfXzw/zTGRYxsYm2NjbbfXD64GtivKx5t9eubzmsMTbf9rTfKRsYx7YR
+jHWL7OoAJpsFBJgyAEzSJiLHxfJKWQgSlJjGduRqRxDIoETG4wj+VgUjnMt5PXnm
+vEQwO7ojzu7lxu7uasg9T00zjrtcaG2RKIwyHx2vUcbjd0OXXvfNafFE3u3t7bu9
+TpJ1t6SKh9vi13hQUX4d307pPHt553zxxHMGb4KrbbvJGTCcNs3WmOyG2fg5vsuZ
+jMi+lacpNcvr0XeKDnafDcIvhyL7927rr7/Pzfj7qLVW5dFKIg8+fKpuxf+vfhB+
+73vWXz3qCPPfw32Mn4c/9mtONctW/fc1sYad9JYn/D1DlDPoyyc7D5bSi3ncMPNH
+bWmvm42eODHImqooiuXwn95XZlmKYKGK7KdA6lrgzZpEiUccypzKofPy4kbjq6Nh
+o/ou++j5g2i5alDG/G3Cb0yaOY3lH7wd83fLG1uQ0nDG18UHnnOOsy+Y4u2Nv5Hl
+jTCKmSJYyBhnB1Lbbafjgaat8zzctvDjPPy7e5IdyZHPSTxq/zkHjinrI5v0/nmG
+Pp+JUz4odkc9b4/cze19oRNOjG2wb+PkWtt4RRjbBsfupHPO3Mmgc18az57U+TM7
+gQsH90UPHJCZN4WsaY383qkbxxO20pI23JHbCr3ssnqkVFJG/lN5x6yQydwiaSA6
+rcgBoSxEDRKIuS1slJsq1MtS6koA5+jFGb17XFu0owrTZZSqsjrkmLVo2tSN44ac
+fvD3aWfOerth5lG/Jlkfp6bqUbOZs2FpVptDIwCuWVgqIgkgJMtDBFi+2FpRDhEI
+JAKJtPXloMoKGWpU0YvH9h2nx/hxra8/8UoaoWbia9EeoTlN7Bd5PNdcCDKemn+L
+cY2qMUXGibc0a33/wjqMN0s8PmTeeup76JA7aKr1nMbhIkn1aX4m5rTPH4aOBlTQ
+I35HXHwtJ9z1XuF9EQDwDnCS3S9W358a/E4pTeTSVvyKGWTK/n4Xp7V4dB64Ua3Q
+BIaDtzTsXpXV1k9E54ousxG/XtEhuaGmyCefTL/r3478anc78deNRjg9uchGVxVD
+Fq6cMZqIdp0ihq0xoIf1zldyBS011SFzq08qfSxV8u0cT70dZgp8ebjk800pU8m2
+s1kKdj+zvmBEEU+P0+FlzrhOf/ifG2tOsmrlp7B88bbCY9u1VFK7YavjSQ7xtE94
+3aiJb59/et60wn2vrgeV/jeNd+O/Wt/fp6dNf7iJA5QICcGyiKgpFEFQiCjEGEQC
+LBIioACSIqiCxSCqIxJIw1GQ0Ua1Vam2qYsmg1rVTbQlmjVbWbaGLbU1kWtlqWrN
+LVNNaaQICZqIhD/QiASyQCUEBKiRKRAJSUiASySKRAJSD/zAgJUghMIgEojKiCf+
+CIBP9wICfq+/889/0uxkuba/pJdybzbJvEsZ/CpEx89uGn3OONVtyYDHCGIxNyIx
+JsYgJYbH+I5RK73DuMZminldjp3e8QpDJju1QToo7pQFEpABpEV4CLQo2QicBAbo
+SEINjsMsDt9BO4nJzGstqAmgEJwhRyggJYoMJE0sJoa0zOdEgXdwiQssy4L3pzbM
+CwOaLEYFDBQKzaJCjFh2yhQOHbgLVMHXFUf7jhKTXPWsNDuEPXRHfJuLlKqls5Tx
+pCC1IgIHnTm5PeWkwwjobODcCdTCa0YoDvMlcZwvmQTkg8KC06oALrhzZqrQmQq6
+E28rdrSUxBeLkBshIKRh04g4LDdsmTCpNKSszbu9lHOoAwkmTDrOKCmSqExdOsOV
+D1XsAQpFVMukLCcGYGVFpAp4Bg0VnXFFjjdC8avBE6BepA3q6bOgot8LtHTiIlkb
+ARVEcldJoYt4Pimls9rpBzDNzeMwOdNAdSkWo4CrsTZ065yPaODXMCkcZCarR0LU
+voX1R3nDEsLtlyklMo3qrYHIguO1Ci7xRXFwJZjfTrtZfAyzUKhgJcLOIzeTvWjG
+zDE27OYME6dM3Z2kVeKcV1I4jKga0x3vCKlcUmkjRE1Zzsmxsq7L3zOnQ8wzeGDZ
+pQO0uN0NpZhcQSuVETbLL2zvKTzqjtBhwIXGaksi8rYKx2Wi6C1J3Ulb1dwqkjat
+FU6mO1F5Ii+bGnOMaOlc5EKekFDaQ9tjCU1yqcE66xRVh1ndLcBt7ThNI8LbowKP
+Md0AHRNhdYOJksYIQETYuK3ytX1UEkFHZLCghijoBdFzCgKJmlJSADdF5CnsMoIp
+pMjeqUgBrXACCcshXWsqyAgenB7IMoT6ZghKl5ljwkJTUVQuhTp3YIWgQCl8eBO7
+FTzwWGBEw8BDaLuSqMmM0wWE6QVsFIpRwmCRA128BCKpdaVunHbkyuScBsqeFjLJ
+qAw0WUUIhMN3S5Keua7Wynjnew31G8jecPcVIYxGw3trGziGoCdTHKPOEpO5732V
+4lnVA4VvKsc+R4OHHQz2JkHFdwSzeiDBUGBiQAJcznd7Z0oCmMykE5KjZuKCyKhd
+5nTSBBtu1sj6s2JCiZBgpYdOIM4luy6evBlYUYldUQQZKOoAiZL4d7fe003l07CD
+omKNzZgXiveIrzXjCZel4BcyY752rec3eRoT6jAGZAGEc3kkZQhLcVNCq+qVFSim
+BuCKZeQr5FF85WTJZzIXXwto0cB2CpntlWr0xWTfLt1yrDg8503VJAdH0uqes4bJ
+d5wsYFakMZlVS7lsEko6gj0LqyENh3rvG7qYJiQ9xoY33UthsUwRtEF6HUjtHWGA
+1q5N1HNgiI7rFa5QiEzuCDZ03KzKswfM7185zaRUkRyiUUssQSPAwlc6CAaa2KwB
+CwsOVTUrpamy4uS+mkF2pVMrpWpG7eYkYjcqSMY+pyDKhDILMmR5HGGc5ml4LJEa
+A2sxQOlwRDZ0WyiDjMTFnLRKRw6sK02ph9cZnMe8fZrmsJ0710vNY0uY4QFbSrzd
+WY7FvR2oW0ZI0zyUKMETaoJFAUTUyWuaSjAQt4DbxyqAYcj2ysQneAWKMQAWMoBB
+hIT0HPY5ne8L49gqYBFQhCXlCmzuzQImhRcjCApqiwAmbWJbzsY5reBB1xT5l5T1
+ybWy6V0tnJKrLM5WHNy+RpkM2cyZ5hebCcdg7aCc7IdY80lCFwSGCAXNmQXb2QRQ
+x7k3NRDGXELYQ1gsQhhUDum3ZE72ughHRdRDe5Te6qw1u1LB7lbNrJow7QT1uAV3
+LMgyxdGjCMORl8Gn2BQuwIUzm8BtHWJnZGBtieoICDTvKJbIMisQ2U1BCZoZlhQX
+ygQBW0jtgQdslCYNcrXVNnBA+zLTmqmqYeS9YapA12zNGgCPsUFmdoio3ByWaNXs
+7NrZuGMrSZWRJA0vOHdOWzMw8kjKrskdtyHLanDtiyJzpWVgjo+aaaAkqTKWLcdw
+xANHQyoZ1XdCK2biAxFgjnDMsxEk4wrWTKgmoae5DQbpESptb1u3Dbpe6qOAZBKa
+UBJKBZeiCwEJ0WgjFAInS4JGF6SCWBfA6F3ud3YtJTVontzKvsRDk5lipuE0+KVI
+KnHbGmhhDdShYAZ20BJi8hNs22nd3MxNWKTyqlNVdr1vFs1kiRRBRoZYJt1SAw2W
+IVY7gXmtBFNaclgFQFjwnNh/g2AZt0p2YbFHgZ1ZkUHIuCAEMTDITBEMBgx4Ecgg
+OwyuETQ7GUQsGRFZENlWXORDAZBg5I2Qg0CU0NEcuCVhf8E4pyCmHivNaJAP8Dg6
+HMU/BCCcRX/CAZi3FTsR+gqagg7gfXVQF3AFS45ig+iMnICOKROLlQG9QyjKyxqt
+rL7DL2NWEoOARpsJENtjCQigyaiVbD8RcRpvD0dJYxh4KmINWGAOAshCD2ihhCBU
+w7Rz2iEeFpgIN0kKqUcbsJC1I9OQR1ARqIJlDBA9OIaiEhhK4RqJxpaG4HNX26+L
+L2uVbzYr6uxSpDYDItapRNSDSPMC40zShplaragEHVTTzmCYzRWDaG4boqxNVpQe
+/U/8feVF+H1z3Iy2hnvDyeOt5n1QI23zarZHe9m7tUTEm75vIImeGztcNqf8/DK0
+7AS3hyuujbWlvld0RqQIdaW8VAyyAqKpJUEU5BBqICLiixEH2fZwoinThP1ruaww
+Wxs79RpIWIc1I6VkHrWTkb36HKsT8aCEdYQp8dyc8nHc5Tn1GZ9DqfXs+w6jU5vi
+5KOwjHVB4s9RJbGxesXpEnueovCTuXRSXfPMqMjxq9le4We74avJg7nrh8fkY4r3
+uTybuqrI5WCNRuBiLUVuMAR02HDRwNFmhVQC0wOxtAjoECQdIAuc+ZfaLo6O0IVM
+EV4FEtlx4W2FCCd0Phvqkylm+T5VSzgZCqK7UNZc+X11LEfD369NnPNn684h236W
+bTiIcgobiiYguzQoGj4YxXj++cs4Tz0qdHkwXXYuqOxh4RlKlgXcTb+ZT58LL54/
+X5UkWd6UwSUtKWg8ezAgn3LlVGy99KvHea5jdcQUuTpOwzdqe2VOu9t12gz7+79S
+tp9hZGnb9KZ0+UWVGOfa8PL8MePzZ2jpXPc6c8Sz56UZnuR7VyqryWOdve7uxH+f
+7i9zTaJuakt23DIbPPKW3WvwvI5hyr5WOMzSpMgcRs3ZkcLrNrzmzOP/kkQSPs/c
+fx/623+62xX7H7t/15ZmW2yT/C26fxC/1B/Nm/4vHf4Y/W83vZdxnDDNatLLf4zJ
+2SOOSTXtmh6bgfkM/aUg/9rYz+ROs5f0f7Np83tXE0ON27ynOf4eduzHucnkr/bP
+/xPo+Tm1N30cm7RXZ2cox/U5Js3cZ8ctGrXWkfP6/AuC4YHo+wmtGj+jDpRjOnhC
+Rui6MS/oi+aX3Nt6cccYzh37RNxmjpw854P83H24dWtaabtnmK/F6q09XRzP6HOT
+UEd6oETQUHmXUt2toYLMjFiMiAgDhaE2Dii0fPTcNGH7p5jf0kPg3fXkttKDMGej
+3IKP2KJOlt/R+CT7PcY3AZxsoa+WREFD5vk4TdXR6uRq+MzKxSvDrq2ak+c2275m
+d5ettnJp+4/Y+HV6qxudXLdedt6uSdTKGaMJP6jNbZZww68/M8PzplDqYusu8ZQB
+AFQUJ8y9CB2DjMriYXiyEoiFRoNAmCWWSMuP4EvGSYUfk7ut8CD78n+j+iqqihWU
+fmZb8RVjX9LiIokXhgfqc+hjbZR8xHTSG2NvltyeEkBoz+i+EBqwZMS3bqJsEaIa
+GhUYwpTgGQIwCHFSPHf9PH5soVQwNtyu3LdB4H7h7qHvPtJPgw2vhhBmwPscrZ9i
+B0ofZ8/K22LZTR+R6NBmMbWj+o8N5NK4btPxmPo3Yvl53M08zTwps2Ux8n29W7or
+ecnOTH4LDyKfk9eenmurrptb6EDAylMSyCFoPt68A+P2W2rxpvgRO7eOTE06p78T
+pM095szdT5dJNkqV9yvdk2KjRq7ZNv2M/zD1uISNH5LRt2dPbXxwgg+aSTdJarr4
++t4IO5+isaqdYSfl2IOJ0ntA756tsBY3I66SOBHlU+0+8bWUbHdtxa1P2y83z5Pv
+NqJ29h6ymz5tztPN04yw5+OsUx767u+t4Wb68vvztvPsCb27OnbrgHffegij8Dbt
+R+cpqFnrpoO2jCj+dtrCBfwtFtxfNrZd9ZcQzVPa9qbeq8duMYmVfF+2cTONb3u2
+m+N7LwZwK24TMUPA/s1xS2PJ211vg1JfBUXQLO2tMacGtLJmttPE59YWnForCNrr
+vbv4+/xy7+NG7BfXbnqKVTuo0DMuFW6c/DBvb4i5+crr56qLSmCHWi131w0DRNem
+G8J8mWF6/BavOE5YJruAqh/e19oRd79a8j2xXHhVteYnEW9a1AvE2WHFHnr7Wf43
+p9q/GjSGtZb51XBDR5fZe/afXwzt1jTi0aTqd5pQ9xPS9+tflc68V3+R30RS3anM
+Z7/OYoK83au2vY962u/PmnmvWmcymeWxxPne1H49bc+va/KVHaqJxTgrqcN7zDZ2
+TweudXvavlknvqpsg6zC6+IavvB2enbrx754TjNRir97rpG62S7VPnth+nn9KvmF
+thTinXkTrfbYcr54eVPbFQRF11vTW9+CcB+4r3XRpMtsKWHnhn3dFDF7PYpQoLeU
+zh639UyDF5ouhQerfW+FKROlO2lJwm+UDcwvkjwQ51nx2aQ+iINt/lkDDTrmb2vr
+xryHii648Xu/tF6QHbUcIFxgYRp4+V7eaLG64b2su+ONNxKEDlYjMR1Fuhvauj8z
+eus/aeYa2iB/Va1tuuH2zjOvxxxonwsbYInfrnTPNs504yedSRkJR0jeaBvNr5mG
+nFr5TFHNub0FVE3034E+q7tfF5n54uuT4o+28bYpzjhtI6mfB4jbVMEd31VAR4vi
+GN8Tu4umaeq9qLGLNUsvpQu/8faJd34UW2pXhjvaq0NFmKDNZ7UjVrNM4aXvd5pS
+g7LW/5p7955Vtvf6tsMfFl9rs3VvkKnfvemaXnFPGd4je+Y3iU3nXv37xz8/Ot5b
+nc6a2J+dPSXnLYpvqfBk7ZifA8RiUeNNauSKONwZWKpMDsKhPt+f5X25+dAjco/6
+X52E/Ys3128FfCeI+sV1Ngs+8/j7+sqrWwKe/0ydfK2xlW+++7Sx8Nr09NQEOaq5
+Z21TVe+3euawND9LPk1eaTWOD2M1bXSfq32fH5WrqCSRodPHmm85a3Gq8/ldR8zn
+NtO6s/E5oRyyZ1pX09q7BTxk/n5j1O8Yr8nSj+qezJTO/bzuIo9vLwYbxnRYVVut
+OL7dQJYPFNnRyNDLjWmONtQBd1AxDZA39o0QEps8eiBrSOQO+M2yN/b3A0Mr9bVG
+5A42A3LcI0uBvqcxzal1tziFTfaXakSnUaaNpTxpS+3avWO1hvyyUtPUe+uu45yi
+4aeNNM2GnS0nrucvjF/OGhoOnW1aB+Lxnmzq3GyztaXeuQpomp1FUXt7Rffavj8e
+Jxqux8eyex3ftOU4rXxtxMYwPRqwXX3Rcbx8dn9s3YtPa1XrnZx3dqikI3E1b3fP
+b83aGWPme0CcoGvA1o2PWLs1K+ceH4fTFuVHzrGWGpHci+dabeFi0V6m3aE68H73
+Zw10nviGOyJI6DzqzFDysrN7Vt3elS/jFreqKx+UpRu/mfHbO2Jz7663zp9WvTov
+vvvi14Hr7KrTbRduDN4R+UTmqrtsy2L5ZVHyb3Y6t0R06bVXuuJsOJpv5TdGqPBn
+vjuRp2u8z2WyNdKcny5v9uOfk2vv7aaeetW8z7wtz15nB6WenehxSnftgbkj3tWd
+Mah+7rRbrONx6m49l1arhpoQIQzabRKaTwFVPoKPOmlsaT9tWeFUp8/XrDuFrtXT
+1Ap74Ub+kFY8KMkmQ4I7OOw17bYmTediZ0ZtqXZakoO7cey6d0rpPrCrpmfgHM/b
+a7hjUcJ7c3OM2GCCHLLJ9KNHOb1c199tbZc8EKX0o9vETvYazOKX1tnTN9u/0fij
+7WpVRTrmmb7c73x2zlpOsWq3PBNjMryyVim+k6qIHV8cZzrm1NNNtGG3WiU222+q
+WvilXLVPDTtuujYqnq92HkjtPrnhn8wfFVRtPKbMlam+ja2nZNWzVGx40FOJoI1m
+jzX8RMGuvpd/eu+lF81TFb00pDIz9nRKTd6RSnvt2s+s7+qqt/jhaRHwyffKQ/z0
+/tG3K+dUXivrmu3jC03fjSsNvPfd9sob+3xr8iPBlBljpK63v6fnbHtxKpDNFNx4
+fWXi+m1XLycVHAWwI7iooCKfX4XX8vjqgNOk/E9udJqie7fMu3gr4Snj7XtqUiPX
+k/dmGsfHvAp85erxqS/xs1bwlgkOcUNz9VxavzsJ6RvKmczE3Qfa3x8N7dfP19fV
+5zBafd0+t4Gv1r9dSf3T6+afWJ0nyP0YagjzqAokAsvA5HMvICycScGRH5DZSUA+
+4yHCgQfxOdfUK0SiI3A5uCNvta9mxHytvJydnbe2vh3ekY7Rp0aKfJeTkcPDZ8Nm
+PB3NTaen67W1s5nLDjLOzJpdra8zzbuJp5Pt6W7cnZU5vM2/Y6dMPz9e5Tcsdwed
+g3dJ1jb2DdpxJIz0Z0kNPqBsn92/s4FF+N/glGnYgij0wPhQuH0EH5P7jwhh/JyC
+zw+Z3IMdOXTp3K3ZOHCvyezHJs5atrTSjQcMZLMtxWHd4dXKNgxw4aZq3nzb+1vu
+cjpvN/b6mqqpFQxWMPRn6H4LFK8ID7PD0s4SMs9KL0KMPT9CxUqLPxoSUfQf0KPy
+Lhh9D1vz6H9jW/B0emjPs4eCR1R8HP7MbkZSDnGyW2fQzpoFHCz0g/k0/c8XzYzM
+Xg5v2dmmnecnavJvG6+L5VVNPmrir5NP/86vZ5HJ8Nnbq3mj04tjyV4Y9nm2eh0f
+qafNu7Pns6K05Gnm+zfa1ps3fD43tuO76Gt3pHDu2Z4fN0c3eclcM5W46KqvgrfL
+ZZ8Ozk5zj2t+GJ1OZux01LfBLof2MVLIb+iTTw/Qko8MWFEI2oiP1WGGjYyKLrbb
+fh6PuDD7yk3srttD0dPqECggsURwgcKHFYVt9Z+a1C4nm6Upa9L3uLtW7mx0YcK4
+Kx0dfZa/Ltw8n9hXZ89reu1qDcLLcHUQNwHtoWoGtuURwwrIGERCPzCr0EbZJDNy
+QYwp37N0hT9ZQ2foLh0PmQ4bKfLwekfRti0fBA/YfU4d3PrbbDZ6xtdCy8gjwLiJ
+ERJhI2+1B1WIF0FdF1DCwjKkl0UI4z0M6fVMf6venWbllsbtgcPvILqxNlq6efK2
+Sq6vRw6K51ebu01V9Z5ui4IUOJjUBhQUeqIhoDPBJAf0TLYPoToLip4WdGkzxt/Z
+762yzA4Qhhh4oHIv3KIDT5KmZlTKwtaWOeREM8623/B6elo8Q1JxiWAgQncQECgM
+LAiWAQRUxWNHd3dxdjkaybr2VslNjq7NlVT2j4cJ2ejho/Rk05YtfCzu1xat+Hdu
+91cvNxDspIbRFIVURFCyHQYewlUKLjAgdUHOqqFXQdDAGooOZKIyENwSUKq4sEFR
+yNRMUadp0PLpEZlE3GfqYaDKGQcHDf7nD8kmHDRh4fwWWYffjxw24caYWfk0mkeN
+D4SFGhHiVFbu2EkgtHFezxIqaWnaEdzJFsqSNEFKpZXphid250aNmnZo7ZMVlx7m
+zFVXDo03KvK3TTdqZZZ0j34LqeGyvh6K8ns4bdrequzHYrNt5jMmO7tq3Hk9GTU6
+GMOGnzTTgbO08zq5PJjdy74zObhx6M8nJu5Vc+Lbm9uVj1ezk3q17t3D0exwYMKB
+pTOURDWRGaXREECYuJhxzxhETUu8mXv9Vjp48d1lC0/f0WGgxkH1HjiPyUUeFBGO
+am8bm7o07t3Vu5lah4OzS3020qqBK4ICgQPb8h8fj69n+3hleET5+1Kk1maNSlav
+R9c8+++/Pnenwej1erxtb6HV2SCSSdrJHVYHikZUg1ZVkDtUEypDVQZTN8kDSwll
+keMwS78akNOMiJQQc3dihLlKj+oCG7aEM7oG4kZW1NVLsxIVjJxmQMVBiUTaWsgY
+DYxiQYyPuBXhdUKWrZb79D15ra7uMfLW1eW8dXOaiNhdxQslkuUzMFKgagC1Ehom
+iOOZC4AyO5qNxXMVogEhIpqSNRe4grNtR7emHctEhpNtsXLSm9xOTBmOSDYeNILY
+2DG2ibk3hUFnKtvTMXYBFsiI1xxoHjiBJg0ZhC2Vig602I1PKTNWvbUbYm/JAG0U
+aUsNNFafJHs1SpG5rY8UsGwe7VRhp+PJFmpjr15ahtvTFpqhuKWCg24WKj7kpybZ
+c6V5CsG96jMayx1GWUOgDVCIZKqhixI3lLuejpuwX0E8/UR6+vsvzdYqEqnmqYPr
+ynyiMGXW2W+XV42wNasYmujHR/B20ne7B8uftj52a23ykGf0r2Fya3xEEDcibiTQ
+0lZLgyC2ePfZkNiK8bqa+t/uN5kVHlxN3dckC7FJia9ve/Uugg2wm6UBkqXOGuys
+qBJmITKhYQIImk5o5EECZQKpHrRxXGOTi2LXQmqWh6LhdyTi01SqSQ3VOEDXmHyx
+eGS7oe6mzQZ5CDD00rOtqeKJjKBw+ee+cWoiUVDVLJ/FhK0iGh1VeKiES0TeYm9Y
+aEWwQmDQoQiRwvF1pOMzCkqwS5CmptDqzik403jShJgqi2UaBbWZmCIlgrKzuoHE
+I80UvVUMTR9bJIWy6iiIAxXukg2P4TDx8uds7uzmTTj2cu9+82j892bLO1fYjuV1
+nOX+0ET1+9s/q59/SSQJI/0pffnnpk32yWNNLZIyLEInER1S3+6lv+L1te04VnqI
+JI1eRIDos0ygqI/u84V/ySnvUfr5/o6avXhuP26/+dG413/yfDY/hOza/3m6353D
+FQf4gPLyckmNf0/Z+79v75+CaSQkY8In6aqSH03WX6Z0X9VQB/vFWq6C5csRuvBZ
+nX9ytV12MkIm7FR+DLJ9H6IBOuiLogQGQ/eRgyJJAx+aYLFFoFE+nXZEmdeEk51K
+K8zR4ejlk1Rjyd9OlGOU1IHRC4Twt1lj8fuDSl+toyn7KlPBdN9GfhbdlfyOpi2j
+7n1z3jf4hxzT5xvpenii/OQ9atPRJOV8YpWSsyBkCMSKpoqNVJ4qi6kbGS0oTp5U
+Ze+1/H5LYmU6Uu362dTHpJsyInEO5DvTRhC0noXDbUrY0aAqh/N252CZJLYxRLww
+eDIgJvhTpSsrEJ4SVDvd9S6BwlgfShNMd9KmGrWk3I52ZEqkIKJiiDZgpwVrTuGm
+0Uo/ZLXM3bFdFTPSQCOxHSpDGrWnDhd5Y05Lm5qtLILG02ERoixRXRkaboZjM9Fm
+XShtFC7OcoJwLVrbJ2vpmlco5wxxJm17X2pWtUowXbS88ViaVfl1mbDdKMZhHFFV
+CHEiCc2ed3C08Xm0T2nd6Uv1K0yITQlBsslUGWxQP4OXJVEfYPWUXA+kdcuh/+HP
+wWUH7diyuFPB1lyF6ZrDIprJE4SEZ7msK+k6P1h5hh3qskj4roZNzZTZjCbg2ePa
+UWtQoyUuGzm+j26e5Sjd6d8bPnh8J/3oPU17aMyljAcLyiBhr8j7ZOg/Q3IF/0Ta
+f6XwNY0RdbAzegLT47336Ne7qtUughSk2m77D7Kk/viknCAADCufnfnmfRa+PuZ8
+GbDsi+jRFrzw3ixPHSw07DIXufXiw4eHq9LyQfWZnFx+S0TQXRM1QT6QbNSZJj8m
+7UMbjp4V/ZPnp3lbJ4dvxkSfH+zJaG1+r41D+t7jCD0giVFEsaiSGe8yzuQcIPsg
+7JTIOFnT68Mlm/XtHO4/DVboellFEFwpf9tkkmQRHs6yXoRCkuKPxU4Z4SueGdIi
+CB3cE9RKuhrCdlwcyTChsiIXrJwrTvs9M61zkDIsOaTPnYckuRlvrVGxZx0zpzzt
+8L7s4WtdLbRACW2FaHvN2uU7i5n0qt00Kgy9iK7Jba3/3pNiLNMrM1XhIIBPZHET
+RypdGC5pZhk1rtje4i3zM6TWPeYQEE2ICad2RgNnBwoZOXY1T9NwigxKQAH9P9Hz
+7gx+I7Cg/gWYSkB3Ml8YRVoO+7qZcd04606nOv7+wkB9/5D9dwJKJD9w/pOUxtmf
+p+39YZxm/5BaSsnQxtYbRsXraiFwqdRNWIdK5L46DjXUSMMKSKJGX16puhl1MLFs
+NjnoaUBMXnCJ+Kus2EV8F1F0KGG54HeshTQt8laFCKcUvV0VSQaPOy1KydMvj2Ez
+AewDB4P7DzDchscafa/a6vq62dZRm3G2jIrBxhr3MevBrYhskfQQhIEa0BTQhzBU
+xFWQUuAIPIiFQc+2IfQGI/BwLEPA90bT/w9O6Hlgj+ABZZYIk4UKMgIv5BFETg9o
+QqCd/YV/CKsIEgWiK+Iqgr+QaKBHSWPIIpYAYOlqJTAzWgXcJAWQkSQfBkVzkTkt
+EBuCK4412dduYOlRLbTkd6BOG9mJ3lkOMIivftOjRKpUQ1n8N8AXRv85sESi9I3B
+wqNAL+SbEH87kA4Q0iLxfAXQzIiiJA+Dio0PfHBFET4KwoGEuhuF0X0+Od6iPDZB
+vqe2ZbNmwwwQNnblG4ZREfEADnQldENc+vyD2hPFPDVaTmO6ErcB2CSrJHawjBeT
+Lu1HHXecOXpfFifajXzf803to/li3IQraCMnXE7aNaF+UhNCJJ6bST1yCMSEkvrk
+EZsiJnq9YnIRyfoE3qs1+5g4qCjgAB/d3LXII3r+NecgG/A/EBhNc2cEhOijxJO0
+FJewHGBzK1YnNiLkAPBkUztU2GMpL0j31B6VEaAuiEtObw0ViA2Qo2CQrPgdgapv
+FCGKU5zwAX48rSmSGfCh0sBAp5Vw+mHYBmgyfBvQ2gE9Qiw2eCK950Urem/KrOD7
+tAApA2iLxtGRmFUGVZgNFMIQi7APICVtlUdVP5fqGLX9TEJBSYcWuJiEgyD+whr8
+Qt4j0BCvhFy3AUJAHpE2ATCfY/XP0YM68EHwJaHTWChL8gPdCT9IoJW04ShPtj4h
+rXUO1N+9eNBzh958PwJ3onum3eftLwTIIDagDw+o2Baej5qT77qlol7lfPlQODAr
+7Qiue8ErGKQIVtOQ+yuebQ9jz0QHR0XSF1f1oB0wm+nhBsV5Dgxx5TjC7ifRJgWQ
+JQKDKZ5QcF8aA+2FRB9siyFbQEtXEFsiyD1KeYp4vn1kdk65sBN3fx5t3nO/Y59A
+R189AT77u6pOAXgcINOFPg0rAnT4ODvDpDvB+Q6AjhNjrJ2a9VBRzOAGZ6eDgd4b
+NoM0UeBxPD5FreuGt6Dwo9RFdb8nAiAa2R1p49xif5Sm4cGGg5x+6ZreF2MUxiIK
++gryR/PfnDI6Q9Gn57KlMJ5766E3pkiWtHqD0EedIKlAC3QaBfbl/j82SCLdu7yW
+v6Hmk/T9Y/qXglgiQ/aIREU3sfkhFsOhToBSbFaUQBrYeBo78wWrCIiT9D1wcVo4
+GjuBz3joxqZU7bQDFwmjB5e74MBLoK0PA4QkclbwijNF7qEEoFkFRROi0IZfN0sI
+zwihRtDz4T7ibJnxZdmKq4qOeIUAbh8KmERXb9nKQ+5QdzgDPcJjvxw6bZ3TBIWY
+SSeN4U3EZkhKxct8oIiTDi7lqOt3Kvi/tFCQEsImhN98ZBnWjLEBK6dw+FxgB1I+
+dDUAkMR8mm+NWReOPvBhDZjk4boMpjxoBGF5Lqkt7tL3kyTUNCK+PoZx3oUqB7h4
+5wEXO/lduTg4NfIqAh8ZfJSAcG/jGkuHA8qr7Ro13OwIJLia9u+yBZ0dicUAxwCA
+kEDreMjHsNGLghIQjFyrYc98oQaGSKediKrHfuebY7DkhSaKvv+X/oH7Ij+oKSLw
+2kgfoPv0+vpfWeMjRqQk6L7QtAATi0oNZJzgYxP1w4HgU8+oYPhFESAjAyvt302e
+CDaAWgGAh7Xub6oUY6dMeNnQh4yl+Nm1AA19panR4CYHnOGiidVdfdsdGvhv6Zx0
+jjJBqQawcqukBR4Ux34pXobqCIL3lHdgOad5nLqYjUZgE4QvtAltbhvPRFES+goc
+QfyAkiF/e4WiKYNUIFjKWJZA5fwJczRRibFGT6zCHofhgW8eydxvZ1UFHu97Toow
+8FguNJpiKoCc0GQAn4ceHt3K0i1feYVcihrJaNBCZJgh3FO6ENqkEW9eLD7vi6wf
+fT7OU2J7Zn4VPfXdnohaADg6HCzQSKlLKttUpsb9HGGYyM1kdbG3LRyKBaAlAEQi
+6K3SwEpXNuY3BAQX+wSMOhQK6JuJ9BbiQxBRmAuim0FUeeYULAUKioFQBh8aR3Mo
+71V1gxByA7oX2gGDQe8klFNQQNSjx5kWPD8XwbJrOHhrmPG1eVz2hyCeCzw70QRm
+PBaXfmHpq4d6Cj30CwL4FmzRhVE1Z3PXGd4oUT3RT2fXIk3Tn6hAxuw6R4ZKzAfB
+E2O4JIhAk0YDAlY3e4AHkEgAr74ycQwAnQW7rtlcpF6JZA7VNu66JrCcgjUCEFCE
+RpghIiGj2TWA7EMd0aiCjpcIQOLL43hkAKrIRD57bdINOGQ01LwiQc32iwDYCMaA
+kHwImA5vu3GtiupPVup02YPe4G+iICJJzomO2gryY5W3M5zx7DfU8YCDsEXiG6zV
++xuOJIG8KOYoQjJHHsGD13J0uAvNmGVfCbv+KJrzyu7cZk07DszWZjii34Z5Oq4J
+YoGxovONSVdyqdDaiI5o1E9gZEO+MOknbKrd3vCGjWOSCrnI7Ux2qgrF1ozkJ12i
+qiB+Qq2iQl6eKyIKevnnG4vy6vIfKJt1EpCX9n+P6PQpAeBRKJQ1sOYCWlkXAgV6
+zM7YJl8sa21D2vb7geeO2SpmkzN+KTwlzt0iohA2AcDPLw1FWDBUJvFW9ggVk6Dx
+nW8ShTWwRlT1sHHJyMsXFDhNL6q7kI6WJJzpELbUQNVIhmsRVy0ajWqqiK9NrXLa
+rEhagikVJEOvbHSFh2axoim1j1bJkioWVpJnTIwotJdInhXvflf6SU/PPQX0bTPh
+CdsP29ywEL0SWUfTCD7EJL6ETkKMZq+XfvOV9/V1w3yP6vw8Bs00Num+z8M7mbcc
+Nyaf49zDIxUaQ2EvqlaeEBsxpWMXnJV3xw2Tk85CvjXKxcvj69eMUfMr8bW8bRbU
+onKyW5YZYTLbI2sO+23t750Nk8klcxbgYLeIcQe/QCQJFkWj+oMfqaThzaIrMI2P
+7OfFp/TvReP9gGjSGXxEeEVFAmDkEvv9VUZSkBPbMF8w/60D9GpeH1QCFw55QkLu
+z9IAXDqKnNMEC9ziBCmelf4wfDqr8bOBhgIc0RJII4qPuV5Nz9AAJ6ARU+oPi6hT
++q8gwvYgoidW+M0fbI8rtLFtXO8iTUFlJvXeyFxmJtnkC7zuiaT8nGztzQSqBLOU
+ovW3gp+vzfBxm7PhlVblQM2bd+/Rh4dPRBvEDSXngueiAwyDAY7g52aB58+eG+XC
+rEW8lGS1QUeWOAT3cakjvwRHNevLrWRGxOBmTNeUHz5BNT4o+AkxZAgM8CgQuYt7
+U5ikqOco13h+zN5A3dAfUbWApJdeQtkMkEkG1iAUlofiG95daxu0Xul4UwF56lZ8
+3m8LyQBioWOMnxAZw8H19FHnTZSfCQ8UKukI6IKbgi2EROEVBFDkVQRmNCWiK5gK
+gjqIqofRAygkWCEQQOEBE3AUBUywFE+iCoPxHKo4qQYSR0uWSDgsC3LBC2FUgIbA
+gEIgr0IFBFEV2beEGgOV2VCEkasTeUI35YWoqjQQJBJsaVFsgnIIYIegAZiYinAC
+KCHIB8L9aSU2jqpgHDRm0jioEdaHayC8iYiN6RSgqyRLYbpYJZUhzsQdYEVBA3EU
+HoIwQQ3BFaiKBRPagNKp4YAbiYCICDIIOliTxeOOGnL2EcaOMNDMGJjKNGgchDj/
+BKwYSZqRlgLQR7nzcAWpLACURHNK7oqAsUjajiiYMTUESEVX6ICF+TFgwSIL3tKF
++9aliQFdBBB/IK0AryCL37njuaj74l8yZNHN1lSjgfcTgmPsJRZVGcrSr8IEjldQ
+KtmKapHX0QlsIki0IuSRcABgN0Gs+4HbDqPIFBxJiVh3OSukGiQvd5nogLDQRteh
+2MyW2SI9oRhikH4T0jXdxNxJF2Xnskl3AVffHjA67x2y8y73Yo5mAE1DhsMmXJEc
+XQigaZcogCwOAJSmvkK59/AZt5r6CHoKYtZF6XRWBxO/0HFiG/lmwBS0IXvAvwXw
+uNK56cJCuiEUIhAnVsVC0oQ/LDomFtpZXfIu324pRnto5FdNUA7OBqemCvdxU76w
+rnterFGPG+6Q45tXnD6WRacT+nbNIk1JCPpi9vz6KPo0aWTYVCFR78pPNQgpwlQo
+7nZl96ldo0qhd6oAriD7PYX3YjYi6+KtyURx0Dh5o389ggNbU0B+KOiBJNO/YO34
+6a7wfKK5PBjVqgozX5yrvYe4b+g/eQESyAJYADkx6QeCQZ6hHDToVxoz61c19ymI
+QUB4ySSEGSTHhMs0Tr7Of7v5ZHrYzWRqmxy/D2PVnfrHr7nmk6vMiLt6Pfbbft76
+NqFfrnncwD0EdL8qWqmCRcAGdrsAgwQV6XyemW3csQRzF17hRM8sNaA5u41TovvJ
+lL6Jmj0Qdj3rXVUPYlIJEIbMcN6Qo+y6+Gy6V0pk2Gw6o2eXyfFnBOzAXCDYADzR
+CSnRaQYZ+hwQZ0h7sXXIQK0DQwbFchiJ7Akq/buuqEJT+FvwSPhCs1JX34emWkc1
++0JlH7mgV6fdrze3n1BaU/HP0Ip6Az60FlmH0F+FDieRNSpsh3JnZieg899kMapx
+A2AgedvbfYhjt7fwdfgTf5O/lUCeRAZEpJHwvsvi+d3wMBEna+Z6+GGGgCoek/BW
+dQo/JYryYiLihedIULrmV2fAYIU15yOAfqwHuI8EwYI7aM8kO0X6aYygiiUvGaA5
+AqKrb3bLK3Bu/ws6awNQMldRV/OihvSGeGuLuQ5zhdKQyvBbunGHiqbSVBLCBBR3
+sJmkCunDAXHHd4eQxhEGRYdBzZu7UXXMiBb3M0jRVaMN1xw04qyJ8G6DCyAXnHwZ
+RDcJFX32jyXoosS3eitAOfuZFfqdLyQBCCB3aIfY2OMhjfbVA5gUvI4NI0ulOm0b
+1FDfrFHR10hZU+ODKMCViSStxuklLxyrOzBrvpkTD7nncH/YWN/xZ/cWB4MEWMjo
+uNq+pDjINyCJIMft7GzDNPmQMmfKO8C3BCupq3ah8aC+3PLydaANlYxbybhnNhxC
+RTyS5wfe8lJ5C60b3pGVdQBEF12XTIjMtk1B3sJLjW843JTV6tmmB3szzW8PCNWR
+3yd28o27CnITe6LTd1rriEPv+r+W/Lr2jtO7uzN3c4O+Tfc02jcUkrJR8QctADA0
+gXSiA676RwOkRHURdCHLXIqelq5LOSTVlo0mrcKsbgjhEjApzpaorkBLDgWikaMD
+WBmkEQLF3ZzJGd55Vbo6iJbSXTzOm0HEagBiaN6SrGSjgMe8kJ1BRvIDKb2rTVuv
+UjayCQnFgki2WkEJGRQCMRewEqK/x1GDBcgGSKNrCGtI59lyNKkdOrQ0UCJT/tYC
+QsXuKTErgmB/L7qWQAgjObGxtYRpoNAhObSe0Yb86I/8koc5eNsi+mHWzWtVmg20
++QHoAlFmGJHkyHlQ13uGhptHj5jDJQi8LDIbkOBvKk72hX8sJ7ueW16GHGq4y9iI
+j3yMYtSIbDhrWwlmqZXVJRCqouUAUhKKoGCwqjpq43WTfM2qub+jk2T4GKHeyOVj
+tYdlk++2vs+/+x5NvlJOLPYmGRLWSHhDrPt8vLxjo69Xl+W2ESbJz6o+epO91qFW
+HfEcnfU/36UAcqgbZ7xi7DdKjmP6OdAd8+vBt/QtBnxhQ5Y55yjps21VoCjTyYLL
+1CSAQTQgB7K2FHCvBzdvNMXNbRQpcZKHabwUfuGc374PhwMYpCQXoDnJZi+6wEgi
+AiX71dMRdTfvYRIwt14Tk5HPrJ9sRIYwCUOkZlDd4TvtfPdgHxB1w21pzT08CJyh
+7Xc8oYd9ZaSpdBvqDRYUDhA4KO7b0HDw6Hwa7XttFLJvwUIDpRXAcDIRWHS+aUSz
+xocp5qowJUFyIVcKHx7WHevE5XHZxO+4peTzkklyu0YuiXbLEIJQUcsg9pabkI/h
+od3gISwZ4fwv1Xzc/OeFHgwtN7OIIX02fD0/FYKloiIWHTB7PYJwBsz1ERDlrZJE
+YDEhYassKO0HhjnoW2l4pHuKoFBPAi0IHcnEsMNIUlBMw4wqCkAz69wRdbCpCqYV
+IiZOnuCR9k4a5ZjWNKYUSxiFzpNQQUVwU0iIm9GbESmCr3RFQr1Uigjc4jisu4pJ
+puPoO5yOeZt1LgztDDSQtUkU+DXS9idDpAhOhoTBeU7AAikkj6CLUxCIImIIc+BM
+GVzqBtTlqMISI1Sc4AgyKiD4gcWAivyJqEowpHETkhIOIUiJAsq4g6inSDsxKRWg
+Yt+3owIGgQI7FgKRip6JhDOMYUVRT0TqgKJELhtSrt5BLVIqtKhEQLggZJ4QhiQR
+Gq0Cqrhtk6wQnTdrZdiQdLJbBMJNwoI5yOuHOpAbHCioJ0J6YhibSGY1HllCJmB4
+jcrMaFD0ewXkW4ejjFIZTGKo4JHcpSBBPtd0Qxs1vmR1w4jyA/Q8IHSlHwHq+Ee/
+WKYiGSG4HC6NiRUCLF32CGopcnwE7g8WC7D27ysTrEzHoRC9BQyGYAhkqhOQBwpF
+wUlY3keYQrRXorRFPA+GhTj5pDpAE7BLgAlbrkDpk7XdBkMCe7aC56ythMcLyB5M
+qB1IiizVK6jgSzmXFAgGIgqwIgA6EtEewNxEDMEKsvoUzTnlKA5iDnmtY0XrFdi7
+oO1avSIz4+XbDYhpYNbXls12lualldWW6Rmvp3XiSn4tr7H2DBIdge2UHx5TmHNI
+B0iD6NlFC9gO0A7Si+DLWvYUsE7DYKO6BRETeHLcg6SAFuaZ2hO+UAetihqZiOFA
+GI9nCa1gvgaJXoNNThLNEDOVQpTOKJxUxb7ouRUN5KMOSuV3bdQuokVEdMKFDQPm
+AmkMhmx1/f2bHBC8ijYJk50C6E0XqgwMJ6K9wOKaAATyGEoaSjjPogj2CyAOQRZk
+JxFQViYRM0i+Ei8gAZiihW1WUkg7JgoKGBijbIMenRopoooFjRhdB5EbkD0B3K05
+69Q6zqcbkOM1FpwnoGyJMqYsuqUojv8cZ1sKM4tO5+rCm9ZZJCE6fbttA7APREM1
+9CSIPRp816UCN9JJBPsHGQVvYZdivqFy+EDnwVAwp4cGED2KJDVUXA7yrAlwDiMK
+5xTOPCYrIplcSlucCUpqSpZoxggu32wzjnF2FlIidoAllPOFbJzD2SICWniGwEiA
+3QNDcV1ngXIKepNW41sRWLhvPSg1vwFIhjFd0VnVLBR9WMhksUIIoiX6b6aI6gwm
+eWGTazqFhRbYz6BwdaC+k9L6lESGVK0KgKYufORB0fYYzTnBemj4BH2gEaHaaIrv
+fxwDWvTnqdY6WgKUpgSoZrcEXkiQwPFhy9jFIQUORTJpUAFrhENwKQV1OLa5FQdh
+FEEkFVhFQCQVCRUlRhtibMFYg7DmjWQ0vBThVntDVh0KBEg8z0VFZ1dnlwvOxCyV
+yFg6KORRzKtb9eVaU6PsPpQ6vqCxMQymmlu1MoOofNGJrbSJqCnCG0ZkU3SmgEqj
+ljqxILxoC0NXXqMYPKZsTNGgseiQX1Um+tDnWCzEFM5KYaQwiK2hebBFtFvWbIKl
+A0gySQIKEVUFY1qkKQisEBDEYcpVOMqLjVHCwFV4coAKcGYVaniPIi0IDFCEO6py
+iK3Sb5QtwUTkeVRqSZvgtiPRiC9YmOGphARNmQ6kLF5Mm9RN5UknKirNlCkLBMDw
+LZGwouEWmYel0VvPJk0f9vqDgB1OMRmKZKIzWahOGd6NWRFAnCIXEL6B0Uc2fl5P
+sIeQC1FobsyuXXTiCpCs4yTW8WkdGVi02BNTSDmtnKPWeq9Y4twF4gEpDgiKRGKA
+rATvQoMREzE7FMRAK9ixd+aTuQoIDMYQZSoQTcKEAaDgwLsSRHUTmeBlwAjqJW12
+haMGnPdB7Rko8t7UYLQRAzDoHldEqn4zfIlR+ahTFDj40bkEs7N9ubb1r5Pkz4P7
+KmacMbzsQ60kjr28eWZT5fOlM3PVqKOMRxDR3mUfp54ZLqzcSJorg+9hoxMGzVzk
+E32DW2JtbU2qrPLpN5Xpxamjzu8wb1lW8jakUx6dIsLnCxQwpEzLzYbSCTWTEZrw
+p0sG2G5EvMnZyhFFF5tTkG1AZohFJveaYcvskKd5SozIJ5nClUEHKNtLZSLNdA29
+uDYo7sXxjC44bazLkkiHu8qrYzJnnJ2oQ08SqTZVlzXJN05fOLkVt9y4SAdhsUds
+ETItUioA4xSCJRd2ihTicgxYcOnBhN2OXCLbNOTBhkqTgh2g0U4XAdMYmaJDRnHR
+R4Lu3sBvFYojVUFkFCHnDpF0yh0wkgezuLUwW6maOnVNAne9DRbH+AAHETar2+Ft
+41Wuaum2jm5bd3WKQkCQUMg9FB/ynAQTMVeIB8oh6CKP0EAQxoFOUgEEvm7+N6n5
+WSrmuWdsdiR+nu8pv3szvUcbeXbM8Y2rYHrC4l+zyLjDfmIMYVsENPkK9m6v+lyT
+5D1f3aEZuONmS117lX6NWkjPZo21sYFwu55fns3WZHrU9bIXYmXLdyesJJhtZsyP
+8XuYeY2qPLzk8i2eMXprLlTUee8pZwCQX5F0LaW8MCu2YWI+FoVCAHBD2BOl9jQc
+oGoiISmkexUTRuFCkqlW4ITOGyomsKYHBjZrY5wncn7k8ejM3ET0XYlJU8VglCrh
+D1mEVbUgnLS6ENcMUAAwOwooznxlE7lPuAKOBPjKFlnYC6ADqLSrEfFWgZgi07lQ
+JqzHsmsUg1ZBbG7lW9a5qOWxHURNRDgomOIhVc+e4RuBqAVWjExp9ZXgMJ2l+KEV
+vOwwHQfplT6irimoKktr1mTvMn1AI6Nj8IOjnF6dHXSm3bQx3SNAEqFigcKwa6F/
+BubLQ9vcq85KsS6AydGpaE6qtgkARpz1BKuNSoGBOgBQ5A1kBa73YHOdtULNUiHq
+pDygDESZngsBXWfdQdUGGBnhtbsFzJEXO68eFC4N2M3gCnwhLjo2sgkKuQ/2GLWH
+g0I67776B8O/3enHovnD5QgD5SX19KJhml4fQjZ7+0Q5JZrA6YidgWYyY4jl8xSV
+sK0myHtg0AKidGTG7nAv1K6y5UVikEpJJeVcrzdb0hpFKVRzLlSn17KMaMkjCTLM
+QQ0FPTr0SQkXhEVoyWhvoQ9yPsIB3yDPeHXPwPw9rkIoDOGz49jxbEtALl682Rhs
+0JwxZeyKgGTMoB+YAhZz8Qa9iOMdcWRB55QGYQwryLwiXDkQLgYR9ATDOHVU8lId
+eOvOCO8PhtQKPJPaSS5gH9u2h8QPjqFhzWX1iUDkBGGRdQFORGvidcljOQQDzVBl
+TGG2UR07istKQkPDezFCw0PURkJVk1fFtUDEY3CtDUhqIFYmbk+TNC9bRLgC1B2Q
+hmoGNNdEXHTlVNGEVIJL1zKJJcvOiDo0nuITwMO7aogoMQulp1Uzxq+a5SU07uZm
+vE1CJnZZ70OyN16aWcbe7CfhB0W5dv9C6SR3sHAFMHzkGZVhljT9BtpAZFGb0IBh
+iANn4yVtUWWNjZlODZOyQgvvs4J4XQtR3HQo1zIKaCGoA3MHDeDBQRyGSIusq+Iu
+UOnPeNgBZsMVdUK/MA7M74eXN+cCMybrgKkJpI2AViGsH9t9NE2mTXEAH2u1lnrn
+3EhxUTGqz2uqtiqAhUVEQ7IFAI05ncwTfKHWxRzwOqtWiKznM7zWPbVzw4j5iIaD
+SHW84UBRM2Z3vmt3R7bnF9KAsRXK5MOIWdxy1IhO4yIpyYRjiTl6klPndDcCERED
+fIAlT9GeQO/FHYQ4IvbAcQGRxYyPYeZewWBoEX3dzOxpl0F2A6Xk4RptVObwVYvR
+JgUdJSoUBw0WAB93YAWGu4uiaiu2D0oQ6CQqYz2svjWxM5GLngT4hPu9PIny6IsR
+ZwrtKctQEYHDXdoRqg5oQ2uSsX4bCJ3NGGNxFpY9K9jfyTMPt60P9tHlUE941bvY
+0CWQSCsNUdyq41StOyY05v6ryYNfhWLruNAJjmG6yfUmfUshkQw5BAYqlskE4XZZ
+0rCcTJIRvQcxBsbodFNqdCpMhmSYhrWBxkg7XIf371jehCbUwexm4dGgVDsU5gmy
+ARYrMvjRHnRAjrEi0GYc5Y6OiwRdCNAUhDcJxjcBNIBhrUp2G6ndXbO7n1V1kivl
+8XxGjFDj0HsLjFztVYhL2gQARiRjzTgeTHDnuVV3Z6EWdEVx3o6ECjQ5rCJk6KO7
+JyyngW7FaBI8Q0m90Hkz6/HSOXw7wPcGEkM3MXsytQGxEqIOeR5s569+9oW4M1qt
+CS6KKEewSrVVQ9Z2x1nmgZsV5A2G0sh3RXUp64xy5NrrMXvw/jH9rrG9Vbajixah
+aXPO4PyEx5aentlmgg3UzPNcyQmn8jm7WpaxrIJeGcWmiyb2JVHMgUcgNYWQZ8qR
+l9nHMTRw3MikGYWca2t3QhhaYddzCOLk1SxmG3vec1U7jhzaLKrbNpl7cveuJ4GT
+VKmHNOGIKDJJCa1hZpVTd9ddzdqXynyK3LQF/1fvHvFwDEEAgG7s21nIU4+UAFqO
+BOzZXxvafGAJlsTLa0vUiRYNbsqb6jMCVwky24SylLvbtzhy4U047dzRIGiqxGqI
+kIjQID2qNEqudsyoALL7RxclL04W5tQJ5QDpK7RHXccMSIKzBREj6ROmSpdaVrt4
+adqfw1EQX0QzEHsCa660tktLxhOLIkn2OyUnq6l1++dxH9/n3L2c8+25+V4ffTlL
+WbIZ6mIoWFkymTGcEwjhh9wUdmPPecx/I04eIAX8Pfv3s8Jw7Rz+F57P356BfL1E
+2R485lDJBs/Jx45HbNb+1znkLrlQVg2n3Z3ePSJuR7bhMxd8mt5Ml7Cna2v47Av2
+ShobDchLus/dr8YRijOCfI/aoS1CEk62/SwaX0d+zqSS4TLcKBNHf3WDoO6NgvqD
+AcAR82hL32rdu4FRZaPc4BSzInYiK90PsiBLMdwBZzGeZDD4g5u3gUBylQUbarAR
+BUBIVnQqbgplEWh9veEZod7p4BlUkk5VEijGEoh0dAiX2FHNFOZcC5CaW4XLEDTI
+SgogmLJAKIqAY78+xmDgxem8eRwYA+e+7Gs7BLa59uFG8ZoVeVgy9USRkUkhykQ2
+gdhQBuNLAzEGQWz6uWiSqgkgPFhL1X2+0eYLcIcj3iZyxIJ5vmkDHss1UAY9Kwmu
+cUvi7vEKuyu0GwhCTA/yoyJyKgfHT7x1mgrpxkN4KkOQXU5C2Mg4GpNJatXYSKiD
+qMyBxJCb3pESGxB3ecBzpYGNW/OquelOkMMQhLMNvp2CszyQXClDLJFNasPABkrG
+Mqh3NC4P2iBrGm2BOkclnvhVhaRISz3tcWC4e3pxcma792AaxCl7oESlxfjoIKJ7
+a2FiDuAweHtnbwXS5c7GQzEPRFNwEFkCQFcwLhdUKEAz2x8RGVU4dMOHfKVIFIhm
+2iWtGuVMhENpjLWFciSZlotHBr+3aNL0JXa8XgqPAEd6EVpKnkMUG11O6XJWr5Yd
+e1Z9xlu5eR7mJ0wHvDupi0w9qHg0QgciAVh2IX6IXeOlrntOQTFZdBawzrREld3j
+PlFqXVGJkUYTNlohLiPDOszjjML0boQtWicWm1LQfEJgpwVZEwVAf1rpwKDiWeW2
+T44FofGx9X7FflnTv57B7RWfe+Ko/xh7BrfbW16MdhYNV5PvlOkBqBZnJhkCwWXb
+ALoENInGVVyEpJHrMH1FM5yhFxZi6xvmHQaSOdy8vvLlDQ0cip0Q10A0glmjphjg
+AtXhh5sC2DuE7wOi1ogHvNgoaKThOzB1lxriiGCeshTQvqL89HPQ+io6J1Omxss5
+Zv6kfi67wFWe2dNZFCyzJZwresuVNd9sV2RTnE5N7GjnjtGhDOLCGejhEM4VqEAY
+I4iKBkRFL4BZuzJlfc28UAYvBA0puE6ZecsRdO8V2w3M1t4YGKaBMQ9gzlCEQ22W
+BSqbwKaRdjkQHC4ixmWzxGIaJQxyRAxHr6FlXRHCtOM7Ur2KSG17m5xIKQuaUIjp
+KPU4oul3DGBPUe9XNE5SjJ7usYsvJroDQcDTaLFrKnCLS1aqHqo1vSGEySRhymq1
+0Ub2JdLjui5Cg0OgAyFwRzuTtrLIETnek84awMtCp9ESClI6GC70L6VcHG5I5VRM
+DxkDYaht0wnKaDRTpUruQQOhrJt5eU9zwnDZsQC8XLboLBCToaxiPIoixht299g1
+eAN4RdbBM3PFsKrg6ERTws9wPEE53AHu9HnSjwnUOBSNrBA70oCmilLYPe+DGDgh
+6AG94FT/EZfpoKj3EISVg8QpAngqM8vmA3SBJCvRSw6yhCJNdyVUolCjZPDeXsG9
+6bxkCEDL4kgQb0NHSghSvjbgTCRImOgQX9g5YQnK1JnCHQir06levMFKVYkHy0hY
+Iko0oj33Fl52C2vKsBIXYs0AwtC0BAVsqkEI2A51DCQ4czmzpfPFmm+b8ANnSoK6
+NuBO5JsE9wB54ZFkSd6awB68gOzx6BZkU0W41kPJp0tdlQoNWMl5ouXnVwAAOBQV
+QtmwACYSMN8JJSXDEpDDXCxMzIoc1vtUCyI83wsQowQmOdEQeu+6wUTUVTUZ6V0G
+BjiUxQLwwVYDEAdoXZoZo9PK2kLxhW04FenMCowg8QhwJC6ISvJoZdAMI4RxmXl9
+WGpq1m5QDogASIegEgDIpUXcDP6wOlBb2oB2J7FIYiZ3rGZXNIJf2atRcQbYVDkx
+Cz1D0GsdMvIO8NzFYSwtpbyZ1nGAWozaQYNERCAeNIRK/KCxiAvTnMSeKBcSoITt
+OIamG40xIsICd7QGYq7g5yMZSfYIBjSC8cIthVOmEmzl5cjRRQSFEKnIqSKUG2y0
+d4pDaUQkJ5CMiAKrdvrMLFEIFbQrfWW0hD7GB2FrFcwCpSROwIDjxYYPX3mjKzEA
+oiIESUYpR3ygcvabgvYb5JsUBDar6xA08yYdnJ3dmc8KkH6un9F+sESctLBFkQGm
+Ta0bPig+sM/K4rcNlicUhXGvkeO2yqSZ5oKmK7mzQnIIpTd6txohrPWxC+w7O7Xd
+9LQtO6uqZLhzsHZpRcxYOi1CFignFLhwDuxorIb1rsUMRBHkUkH9+wAqL2aiyPoA
+lLwUclJO0yK/pNNLRBkAgxgRJDowL+MDbn7aFmDs3Zum7TMmpl6eNnnKXjW+cIZL
+KTUDBhEK8ciqkQeV7o9nO+RdjYhyConjMQRTBWmeLu3GkKYbSDZ+NFythpRclB0u
++MM9hIPy379/P5JvRp9K7Hh8rACxIThkR9bC/mjT79r7kMrZfL3DsQq9dPzd80jy
+omUQ0MGQccce3Fj7MWzP6VNxLUm/pBuxmmyioIE45y9suzCqg25nIpkvY49evNI1
+vdkD9EHHY32D6/Wt95wXiY14QGHv6Tupr4QlovqZsUxN/gppAOiLCJKKRQoB3Tq7
+wOD2KVRzt/RlCRyIOQHSOSr3uh4krxkmwT/BsrQ79YvUxmCBsaLPe3BE9rd44cRs
+EtHttA6UiBxgHNHMBs2t3WoqicOUCJ/pdOhWwXx0xzvjx3O0KVN84or1DOx3VbmY
+XBKjiLHHQ6cosigwdb8KKicNL3O90EPY3XkwoBs5FPf48Tw4m8Z4osEyHXmsb2fA
+Ok4HFRdQRcU7OGXaHlQhmiCfcEzj2hQNDNA6MRu4t68O2Z1CjKZpojvIZ6gSyZPH
+rL9rdnsgo9LEDXNXd1XbuepmStaOYiD4/r5zmElX0N6F0Tz3VCoRv4sIsFhYUIgI
+numbH4pN2G+IcL7ABCaNu1mNj6QkUIMAhtoR0MMPiEUwHvdwMF50hG8QYCTnhfkt
+UMX5FQVzDOdATVLQbTBOoetSGcCjNrjgN51GgITFdoNWnL64lJHbNklnJKcjAsED
+6LlEuu3zlPY6SEcibIy1pLUAd0IHMRZuIwhRlzAXsU1wRK4F5NYIkTsbgaGKAOrk
+3mDdrs9oHE5vbz3eO7IwqJxcJxDru7DPr5kZnfTpXLnLVEx7eQEex5Vc10EW/bNS
+/UN3fOWkQhgOwHG8e4Yi8HiGe47HhLNWwnMlMsrBHoa5VyAyXB8ny2xOvMcOHDgH
+b3EqkrzSChHUyZmLI+6hu7wISKUqFFKTFWDllLromzIiucDwBOQQ1kp6KGChwrGN
+IdiidKkg6IolNojcrO0BeJ7r7kxA8TUb1OsJ0DwXlDQCiVkWTKjwgEQoLqhDMXRo
+Qo9pGorE3XPYHlVcm/Fl0ZUNWuXAbPgxVowsObJtykwDZmd3Rs9kF7ovtgP9gQ+4
+ImoCUYDVbTqWeNIfHhQ3fcGSykKPKGvzG0gw0ZETg97odgi+CtWJvpYu2qwoTAIs
+E9R6CGlAcEl9tTTwETIhk6KNV2KAPhQLimtCFryG/Hiw3nYgO3u3TfEJHQuFVBHi
+QGsiLqgzs4bdm1MO8CUwBqvDVp0jQlTrbg64FHW97NcVIgioHQCAjzim4h2byc6c
+ANEWA7Wm3xWoYIRbEHeZqnzzDMAxmjmtCjoyJRko4E6qJSoabUiR5UHY4rwkhjGi
+57nGCJQGyYa6EIE1ZkbQuFKKxvM0KGlAUTD2PCxzTTr3sa2oAwP2Ie5M1JRb4eh8
+NazCTDn7w1nJjXI8EDCKsUADgQVYSIv0oS9b+UA6gPIs1SOiIhCIbAeri0sZgp2q
+Cjt1qVoBinB93WUFd3i+GNTr0BMoqCtDIo66aNKIkZtiCtBFYTxRAkbRGHW4E2Qa
+wGELRMBSlDORfaNHjJo8HetTIRdgB0R/fXAbO2dWJb6DfUEsipYiw5A0GnF8Ezhv
+GlTxeCaEA4SjJdyifLMm9GUIqQiABhBNrSrnBJZwcLnsUPG8AVmRARIaJRIAl2Aq
+vN8GsE1zgnAAG4OQm/dxkQHKoewTW3RsFeU7RIFDvSeKq6tmLIwK8gvYW2oipkRT
+wRjRc2uNOhMZYE5yw8o4PRldld0CRW1Do6zyeWGLAfbpCqPTGDSqcoJXE1eKBT20
+VES/Gir1g0EQCpg7m5ZtoK5GATGOZsXKcwCUdiYw78huOate6CDObwFxCKBgXHBB
+V6vNFaO1koc5AG7nTRtcl9SatzUT+2esG3qOOQchoqjI0MZiYEGiTyVZp67hPaez
+0Y0m6xKBzy6R5ZAO9vJiMqshjhrIky5HVSaeZ5qEyNVLWOJtWG+4jGMGDZuXubu+
+1BVxAySGWyePnaGc7uXgXUFUo7J3BHWdzfN0ndx97DRHhMuD3FIbtcmDu9FIUiHM
+wvJzV1rl7V3DAElvIjuzuAN5aVFegjAg8oRCh3gtOg4EUlSNQ+g+YCsNL0DFoWiB
+8GhSYOOE2b5zZHnFEUAwcmIWCMHBxMSoJhWMWrtE4EJmAmGLhxoTvSHCijrgpjFw
+YaJ00WnSJr+RmC5jFqtEbUiI3kQFaXgg7vKLYF/fBgwaV+EnRk9XQKQPOgkBdnA8
+kKDUtNQ28kWcA2LCiCujWK5nSsg+u2au4siUCIIuFgTFpAqiDAnZW7L63Tx5sg/t
+IR5eMo5HINaaOXDMrHyG8ytg+NvLtlHBkBo9kRnrKYt8/qyVqWjj5VEqVy3GpUqV
+hixKBqJGzkfhHgoFl/X1yrlEscB5vLEAKPAYyGQRirBKEZm6RZfA9cJGIMRHO5ca
+CEW/DnIynaC2XohJQkB3yhFrMFq3qxHJ4+QOtEUb2wG1dJBDDTr2sZrvJ4RcRMbT
+qH2Jdooaxt0NjDiScucKju2YzYaBBzvUkkz7Rs5QxX2gwjkdYD4UtQubOAigAFmX
+wNXZ4di59KNNkgtapzDO5Ze1RNDg3lGlzmLiBgSsl48e7xxrPEEVA8DigDOnCoWC
+NyRTfSavpnxLQ91Rqpqq7DJKoyD2FuCLkgrmASASJuqhEdivR0jzeV9CZNSuy7ox
+U34bo3ZBM43NBAmhDigDK71FQEKZjWNaenQQjAhUwtFmR3diUG9KvqSEILrtcrnK
+JYMYsRyZAMUMhxGC3SmHeUddC8aQDaajNAGHbXfMJnKQ3Io5u809jIeOAiCmGwEc
+SGxFf2Mh3Ck7Q8NmAQs8MQPGwLfoDFgfOCTl3U4o3sLxM3kkQktElpUOIQi8KGes
+JJoQV1lFdBdVKBU8i65cXjg3ziOG1RVyGUA5EA1Bz2PdlZvXiVd3sCFzpi7ZkuuA
+okzCH5e60sadzfeQCtFe9t3jHrFGwPRHJzHlWiIzEmgstR6IY+MDjh98XwynDQJ9
+BcV2odeecqlvFnFC/t9u3NHjnIqGa7bYikVnM+yf5vO/or7fvUJSIr379aG/2n64
+/p2BO0/o9sxrOt3vIpd9x5yvc+etFPveVHuePsUB3DIaidl4CxRx010k46whEN0I
+g9O0ug506JYDlFzQbuZEuMBAWvO6IBV8LQl756E4B76UHCsGLzEOHBSd+XvXk9WI
+YMbfg56ndwHELY0vRDPXRQ99d6bL5OdJIUUzbJDqWMfi11tQANmXKblIsgFamLRx
+GwxzOeJQdSQi75cWKugYgDTZ3sYwfDRyoBTFJzhNZdKia3kOBcotQFEQCbS2nCSC
+TtEiEuncq5ywL4jCuAjum3CYQzZnvAElVp2RRCOSGjCgOCgk5JdEY3YqtbGzSJKS
+UdKYzo16eoPENGLo0phETPJZ6OIkAK9m+kPCOQTXKwGmFeO3Qo9mYJjmt47wpZ4n
+OUCpkBXxs5+EADfPu0KwMIEgyIE6Rn15vJ9n2j32MTvEFNRG+O5FKG2lrAqyh+Tf
+Rzh4eWFJaDwsQTEaSEdaoYgZ1LlWfjUAeC8q2dWnJ0LQ8IrFg6vYcrdprGOfYLx4
+1uAB00NBrexzAOhxEV0hJgfdnNpAR2yetGXXTyUK7POeMFSwUcyK0k54TYZ3BFZc
+82vsHiaF0rspFEpTTqjrGMohOJwo131kTcrGNoxl7VJWqRTYNtAAJC7V+xyyGxzg
+D6IYN9WtIiQNBELyUK0RY7CBDsyDhV4eNdSOX7wMOkXgGQkRysCNmAEPpdYUaOma
+XGtvRVaKBTpnHMGXsHRzNvcHtrkV4qMS3LQYC7AFDRgeIQXw4+CQaigKJZLolFEe
+ynETG9VkDEWb3PCLQWZvtb1uyQ9OCb2ljqdYeYVQUVrlhSmZCCLoCzeq3qihdKlC
+FCVu9GdtanaDaeoee8Gh0XfV746AG0mFR3grOkNaEV4oAxcwugi+5mLavDgNyeab
+aPNUAdaRx6GueEE8UgBraaEPEBA90Hd0IoiYKzzLeyC+QP86S24oNGgPN7VEZLkc
+3KKB9yaO3suM7dsqIyXBAyaPJIVawzuyNy8Uis1TN6MwDW+Sc8Jp63uyww2NEo+W
+pXWbpGdzmc2qkqcY5CJNMqipmJnZ7lPXMBYk5A0CO8LEGgRCLCyFEGqDni6GFwh4
+ISrK96I0lzDiiuVYcpktYea5V0fSBQQ4HLSCYxVJEIpIEG1ivgPWGQ9zRCT5pzks
+lUdNyhMqyFLVbXZ+dbaAL5MolnGQ0f2Y0lbErTW9N9zvnf1PL7QhIQj5Qqg9+9Ze
+cP2k9FIfAnPPeCQEemCDu+PpovnNLGt2xn12fm+7k++eYUe5zI3I85qKYoJjmjnl
+nmGtQxhZ8OrjWLs29chu705lyXsj00pO0r01isVaNX6Hs8cRtAzPRBUpl8Xo2aUU
+RMFSH1bMAjgAzlpfCL5AHePjDzgQW5sEzApAHGDajlxaEJMRENKpBhNAm92ON0Jo
+cKOslyv1CmpWvaQTDp2e7sgwMWOxFETVedrRILOecthi4+kHbXO7UCGYShLGHMPL
+BFyJnklnbddyTMMgm68FBsVzHACN16/QBHAADr0hyZ57ivEsZjdscOB4MukOoq75
+3Sm6oznxvBWSoYDs0mM85hVF3AUJAQhIC+IAnAQ0nYeBojTtDDu9fb2ZgfOvvEtI
+Ir4U3SSAbviqYgJSp4BnTGwbatDG9A3mGF9hEO+hcZwvmsmKw4IUUYSm04b969eJ
+yhd9UFNe3iSa87znSZ8uMCA9unXVOthwgCtrI694ULz3RAeRPJ0dGGH4cQq8+E1k
+N2XKOIV8b7t0k3pInQ2SYhUaCSxLkRMIbumyj4sTVz8/OCjnFqV6iuYCrEQETZhg
+aTaO1M91eVU+0dN5lIKE0hY+6ZhdH8xPatSu9IGjiSBRxdlYhnVgx3DM3OmAAPUh
+oivOGZEA50UKDKlBGKmuKZHM7ZnaIrey9kZzbWmTBux5hLriaXv3sCjh3RSQN2Km
+seQirWUXffY2PUwR4ix73JkV2Xnrhe5wc7ATvBMNCGsQ9s1jt3XLtQAW0gIAsK7i
+GYMN4XZoBFGRARR6qCjNIi9RgC+TuutUGw5urUrW9IBs3WmZh5j0JAQtReBHKKCw
+Ao1BYPjdMlMyTuA3z3s5HrzxCD7DNUpI9NKK1QCbU3u6DYiKaA7sOUSYFvgSL2GV
+56raInCNge3z1vokDQ4oBA7DVZChDpWQ6HOcrY+5Qi5tmkDUUFPEQNwVKiIBqChg
+igm4JIiXEAJEBKiKBIihiUjIdguH3TxtEV8CLnCZZJXuZrns5yGzNcQqb5nRD8Kf
+Ejj1uLimHfFsXzlUZzvk7zxYPeGzkRdgYzYoe7Nc34mq1NfS0+Tpc572vBToIi+h
+NC8Ksk0wShGEgp3jOt0s2159erxfPx1eTb02DQXSuDB5AkTVTpTmMjNgcOdrKEzr
+tc4aYgDJqgdKhmhE3HZulPmAHB7632oFlcTlmCvKgosDR7ft7TOgZfTYJwR7AXuW
+/S8+gIFeKNjkv3u7oLzAyBFiIY4bJOh4OuYdqgOIWvESJAdRUwkRH0TBzeSHfdN6
+Bz4E9oSSCWPhUXvDkFmbZ2uSLokHIEKenMqeTFXgg3poKBEk9zF2SbQhJap4uGJJ
+FC6V1rXoCFhRw7YcnMjkezOEULe98ME6Ds0IYzERWbF33DHNcyL7qBnaeKKU8Wx9
+AYMaYwHMmO44OFPK1nebx24PdpQEPFOIOCGGRgnfbPFFecB7CSMybA7NNoCJdWkq
+A6uxgQHTSlzjN02jfYhsKEJKfK3grm8IX6/ZCr04RBTyJ2sbuCdybNeEICJ26MbJ
+jeDS6wgqPaR9ormfdmFDLWdBF0bbY2212EiKqJfXchQkdNNXrLktUifqXfCq84+8
+Z6VhYN5i5hktLGeDvDyUvWWAs27y4SHHMOtg0Rag4RHHJZJzJpVzqEypuBMu2xKI
+MQEgIgDMNB440aFxBiGgVIhdjaNkyK8RRKsepNlmwLGE3pI5dmBEqgxMdV0KaHO8
+HhyQ2xG2KGDGNoGzBt7biE+kQ6Bod7WXByC2xtI4zTaLsEoGd3XlmZdylWF1alnb
+M69mJMgnkxqru4Oogy+Ri7zgqVzMxct3GGZgXGSdkzJjhyAuE2PZ723DJwTyMnjh
+l3tHY5VDpUieCoJmSC8uhRWOsIvHrs3IcXRWXW5dAv7/778fUJpA9gUVtiDse9fX
+eLqjFjg9tC9YHmeTlFWicKAUpOimCqgEtGlSNGcpe3u66YHC5aNSJLww2kUhcBCo
+sQJBzkAYmK7l1EZTiK2JEzDnWILQWZzI5NHO5yHsQScKeLA3Y1UxANcWcBcAXTZC
+nG3WEshvETCEE/bPauJ2LcYYpkGUUtAj4AMoK/tv6dyS4In1VQtIbiS0kHqwagwE
+s2PM5itnuLiqWW680Rhkknpn2RxZA/NquFxL9qJ+MWTj/aqbZM1Eg28nmVVm5HKs
+lPLjlU2yZl+lLy2b+bKSNUYSElldBP7yb+gMMPeIR9GJowRgkgRoYVdqHQlwIDLQ
+aiI6H1XmnDYFAee304yulhRgMIl8rODvjPsYDh4FRB4lS0XTd85zYMBdO9uA1XQj
+EQiIrzFbmDjy+83gvNdxScSEU2bnSmgAjjhZ0eHKQtVyg3vI5fSCEKUQLGWCcN64
+SoBE1gka0aWw7IlYUoJeMdqQ5ytWEITjsqzKm8ZQESwE6E2CN4IIUSEnUYdM0vGl
+bHppfLXOIXBTSfWIgFSl6IChy+B0e4/JZIPYtHBc8xqqNyEaYZAWKNvfjpvJ6pXN
+iRCGxlbePrTJreU3HXYA2d8CBSRKa51BpHeF0vGi5yH3vMvA8hjcyHuijgTurUuj
+QcspGgZqbDJsCwLljxYqwh0UedgzggA1oQPI1qSzDKyyTLBusjazKdKbN8Mpiiht
+tahHCFFJFECD5lOaLBoYNnSA5Vo0uVRGun3s3jbMCD8MAOHpiyBtrvGjhr1I4Kam
+hC90hDDgrxsCgbMgmSDrjyPJSVi0W46roi+Blde3oaM85BCOMlkvxXOBKzLEV9tx
+jdKcCx5V102vHRvAEBovGic6QBeiErtETJWKgpIgxvYmMdZt+YQ8c1CsakICg2WZ
+YJ1wKg5NIYcsHI7TKYIG9UiK5Dh3nMiYQyjsFTApEA2cmsjhUIqrYHeoS28gi1UT
+O+eZXGRAHUG1Gwk33qXWInhbyo5dSTqBDuQtgRSK2UpGW9OB04oooTkj1I1XpEzE
+sEzSF8gCdoVyiYDkYCLfSn0SyX2hCQQsiaxSyGKpCEVn+T+7ACroi7X8aJopBWVZ
+ZWHIQaTx4SNUeLDFSxevebd+cHKoaR+Uldj4hZiyxAxiEJPs55pQEVzsqkE5E3EK
+C8Zrl12Z6ZyL3XJIIiYtC1Axc5KDSj612cHXeoDiFrcpuKKB6LCLGCsgEWAcjIYi
+7hqF7Haj4908uyiAKrcawQQ5bsgLte4FvgR3kPuHtlEgneUBi6RqG4DiDmJiBIgS
+VKzW6RQTsDZDRB7vFB/Npbn3thjxnOfz03l8o4iPr5vcTXayIrevu4elRUVaMYKB
+TVWh4hpU3OBfMUdpqaMvN5RfQRHEA5SRsCqgNvSaSWAjxg2Sce8tmpLwQTzaEJKY
+a7vw4DMq4BBwDCYqTySZ5Y4qUEBqrTyjRBdDSeJIR3x93G24dW0Fsfb52b53LqcB
+LxkrVu+jOgAOVeWKSAPYajZnWDo8DQrwVXMRLreCHM8HdKQ7MnILkIj3MoONh0TW
+CXGY8bOCBgAXDflHcvJbxkD4icpcbMiA0ObDPeZMm9qh4TsxeYSrNdsERNogpnNA
+iWcLBMk3AFNaaFs84CFDeDFXxodhl7a9MyVyMFFD0AIGiNGCvoSCLqpw0errcmtJ
+ZMaVMLAkEC6A0HNHB9bcXzSDliqUfebISAiIRkyhvuGM41wC0GZ9e14N0k1dvH2j
+IIzL0HDgOgo2Teq2QOrLViXLanCQRVQkcYimjkTcFagkgFwMQzjIhkESKoRYDARO
+OUM3MEMWezt6GgSuFhS2HQXOveJgcUGzsH1FZhnVaE8D1kRDjrF+riAwE0VbuVvu
+Wx0Vo0Ivo3snYbRflxgcfJwR3m0ICx85dsSDvT3cZ29Q4CWGBQLggyCKEiARitqr
+sNm0fTrW3Krxa102dakYpVhqwhVCrC2SGOlkRk1UlqBaSVYVJYN7ERi1FAbW+G3z
+51re5VjVbm5W5UlbmrUmM9t/6/T6vv9Po7vhq+xJDxqrZJCSN4A9ebXxyczXxmoN
+33VoVPS3BLDLLHbi5spPNZK0uCZvZgZzc23MBvtLdad1ruTZJGVJwaelJw113fR8
+rnExqR0PrSFjAyjjVUETBCGwkwwK3s287kNjE+yu0Hbm242i5VRLlk0STTSgxaFK
+RQ77zTcyWsiGy8yIrLiHHJjtG1A2Yw3W9UlzdFd2HcNCqkQgyani4Bu3NroVFnYL
+2HzDRFdvTmig2HcOnFxATrA0TnGma3YZz0ymbsQAYJGBFbqwZSEku3x21FBfCArF
+0wi6MyRrQQhzxXZCortLApgcocDruDxkuASSjkkCRHHVa1oVlDu7SymYTanF4+3W
+eROwxPvSBh9NNJ8ik1JAnwJivP2b/k6eXnnoQc+e3REtcmUhKCgg9oIgj3cO94cZ
+1/yZZPYXmLsEVzL9wyayYqdoLf7u7cMaiHlnOXVcjK1tFvlVLZVUn6CtS/Dc2MGy
+jQgfhC2Kdjr3P4oF82DpTA7dJI8fmoIQcC1skeRzKgLQfdKJKWsxDeDRAOkVD1Uj
+6REe5pkkFtcBVDyBmsYcJiDPKL4QYIAKg3pFBYsEheQysfqhKb7Z5Wjm10jpNiZp
+B5IyQBQMUV05k5WF025JblIlxOjYPTSQS14ht99a4g4RAIMEXBQ9VYdUOnAHboCb
+AM8xBqUidwUIqCaNuDndlLcheCQRzyDZsza6jpcC8J5t93uI52DOCUmxyBWG6xjU
+DfvcQN2R3loD2RQpUCyjb0Nnj8jM44gOI4HkYOhJNFBUaBwiiugHBtgmVWWcPJ2v
+AGlYg8pB1knDeEQyYzoFW+nZieSuAOXHdpQnYHIIvsnV62gW62oGOQSq0ZHQmkz6
+ve09eR6+As6PaDEAPBAjCRxHiizSKSWE3lI8fDOCDmGnmVpNbi8eUVoBcnjVYXJH
+Wy5Y+Ig8gsiDUDTA6xDbTXjDHGKyNg20+8AoKRpUzjVgeIneyymHNIhlOlRveBNb
+AyNu+YZy5q7JQKKSSPDgYkgOZ54N9vTDVhqc6UhuwvCADsV5z0KRpEITXj4+mgml
+oIZg4a71Zlm7m0gkdp4U3zAnK2iHrqjsxi8S8sDdGDo9ucdGhjq81Jfa1MiJSKcB
+A701FV6aw8Hp7V9EURNiZNADwG3dhrhp2xsMQdoNaPWpg17FE8O8dR1VHRzpUzs4
+oW8uITBTDYPLynlwZDIItG+CIpXe2AKuCI7Qs1rnC94AEyGbMuhIPF1HgmbONCmS
+5k7bSMjXhXQp1OCjmkAGTvLOmI0HOAt3YzBQRFgqFp2bepbOC2EIwJLOpBSCVEHI
+kdNxHOkAQs0VIpgJl4XMHMjEgid0t3FO8MJhYYXY8sERIghdxq3vQKeC72BkdCeG
+xRxAiGkDGK5LYsCK3AWW+AM5VQaWqrkJ3NiK8HR0Oyaird7M0013PrNY4oA67ZPe
+zuDTrV0oZMsRpR7ZipzQ1jzg4Ut53oN2DS2qHRF3Qms17VFoJ5zQGLHnTQ1WhcBQ
+uEUTQhQjEQUHI85hT5R2UYC3twsue/zOINAzYK9Mg24cwzR4rXfuB43f5g0wg+ma
+n54RRErdutOia0EPZPBoCriZ3WIjYiAiY9ycBy8PvV0fdNCtr1kSkUTFpWjZQ33A
+Gh0a7ep6g4nkWoASDIDjZq/BgHfve9jgEEhzWCeQR7Hli6A20uwCorkhnm7lK6hw
+1GyiXCVzPlIK80MpCjwRAoagLZOVxmZA+eBSGhCIL9tBXabrpw47c5zKNaAKO4sL
+7KvUaVGgeYA4XSjsTXG+b3fBFtoGLhoKvIHohI5zzHSwDMUyPCJ8Zjolsa6FJ1An
+5EizYQKcpor6HHhk6GdulzXbHMekayul6RlzuOIXQHGhtCOsOrdgh5yBUI4QD6cJ
+CNmU1QYJoXJADgxaZvbMMEEkHSPshs7OGaJOF613Nd0CBj2PIi+PXV5W90bvAECz
+SV7CKiJiGUeZErQbfUGQNmjhny5vomzEBFviHjwiiJ0o1E52tFzGaXbdCZ4hwwYE
+QPQQkQZFRB5oqVQlVfs5E1NSQq6LJmIhqJUJBkSTmKRwxxBG4hmGYgYhOlbgcIM3
+Qhnd3c1BbjEYvIhbZzEQRGBE2cgI5W4RhHpgCsRsjcdWFMN0olQDA5nd4AckRPbG
+2+i25y8WqkxW8Wupq+jB2ymQckBbjqGGJ2AtMuBuG4BrSNp5MsuWwgXbcCXcIAxo
+J5BTSW05do8jzcwVXNZNxgxuimapGRGRMeE3YqpoRFQVEB1gVMQgYxo7G7bmRDES
+u71hcZac1QBCRIHe0LZAbAbHxDwuLIhFlGQ311uRlODv9YkCQRH+Eh/r6Q/7bT83
+9x/Fr+4/N+xjJ/ef+if6dubx/+uT/af5yl/qO7x5v6rVWuWZlZjM5eZ/VustitjY
+3HC0dHExsx/qOenTOnMdJLi6X+gqTDD7MX/BpCpmFwf/C6fg79fommh7CkD5icKI
+rVSTX/Uh8fGFGKs+lPgrQH+bz8pu235HwdPyPCs0aP60bPSYwmirZ/oP34xfQ1wP
+pnDAX5KPS23/G6nZ/TKCJiCNS5oIRTN0GCKEmhG9kYgIrr/UH+fx/tEuBL+6UPJP
+b3bTrJphJ0Vu8PmOnIeyvm4J8dKtpVV7Nxk1Ldm7r2f9z6VbD/lVr/jIa0/ZP2/6
+fsPJ4euM7/l/w/Hbe2qPmk4Gye8+XFXSsxt8HE/hOObeMcPpNPb7slXdTm6OZ/v/
+5dVzU58rFtJ4e3yv9l6buQsjiD1R2Np9hTyeTt6+038W47SRy6PY06E+P3JOgWaQ
+hHAkkR/Xh/2ncXif2afyf4Svf5NvY3/UP3JXCqfaxkZRL/J3CPDzFxNGAzKcQTnd
+cHPayzzbvLxDd1UnVvMbTw9BywcPDfsc2zm/nyMfDmf932T7p87KrxgyeFftQ+tf
+Cfh7HZyeE2aj8Ld3bXw43xb83/u3I6WSftIeD/xbZE/8bwT5H1OjB9vDc2fr8Q+u
+397X9Gf+PSdnVOzpP8PP+c7z52c3SP5Gtkn9kn/w7H1cp+5o+HrPZPv7uTykTn4t
+qMW5ktlnN5X7r3/GJDMMmGVMJN7siu/yfnqffmvSXMu6ft6bOJlTaKqp/L3k/g2n
+c/7fv5SH4e7wSNdHTnGSe7brKd9m2+rfs+75c1sWpbaXqOkkpTo6LvZVDoKaaPJd
+rf6/wabfy//P+Ses/dNe1Wv4P05eaf0Xg/vluP7Okm/5eu4+LJMnvJ6vyfdiuNK0
+Wbn2ZOW7k/O5dVV1S0twqcn6SMKzp/2y3c5D8U7EssiWcxtqybtlfi2p2J1xcn7G
+nI/NwcrP+tfj8/scv7QZ8v3tjkfXsw7Hk28PhyNkcPY3e7To4dLZXs52SnOcp+0v
+BzIaa0rMZV/r4j+X7dHd5OqeK/l2Ng6ZCf3R4MsiMaozClqv621/Cfwfp/G2c4GO
+dLV9XSfLMq1YzWaxrDFXxLOJ3YfCa+Wpzeb8XWTm+JzP+IICf93/kNaqLaNrWSqi
+ttajRqjbapmqtpS2qxVk1bUlWpNqLRWpZqtJNKo1U0ttRsy20zVJqrG2wBY1sVoL
+FUWJs1ikLFTK0am2RVFYUrYNFpNtTCoNYjWpaFbG0TKLTDY1RrJSWwCVU1K0mkrG
+yUpUbZDVikMW0bZkYotZMmZGLRsY0KIViLGjRsUWxtRUzFiTQaisJEzIaWTNYIjU
+RhTZsyUWxsUUlY2oyRsm1G1k1MhLM2Q2gWRRMpDGE0zA0ktFBaZGyBETCCMgSEaj
+EWjaJKU2NqZFooxiokSIyMMUIWEaiMhQoIiiqQmIYEkRhFpEhYqSGCLFCKEMEEGT
+9mvzf2fuM6SFZC4Qd9fugRia8BBCIvlh/UPmUoYBieRgSMiPA/zM5kG80OwWXxVB
+kDKCgX+vVRm/7UQIDInnOZ/vuDq/4D8+p51Kq1Jw/kWTzvI4d9a7SyLfWstuvCsR
+8vO+Ve9WpNJv7s7+fuL8JV+dboUuDPzER7chJZ58smGb6bfHJ+/wytuIdr6d7a47
+bq+tvU9ubKTxSujpWpbkOGArKSYHFiSSfHgG2RPcG5lSlkRGbrdlTVFVeA1pC41W
+V8XE0QYWbMrorO7DWTBoBRpgyaqKdSFItuzQ+QpmRRpSUkgkAkgVhutQk5vCYVVC
+2pCBtTYcnZA1HRmQ5KEKUJCjE441UykKrp04rW12EaksMjEqCmiOKKAiIoVAjHHG
+4Oy2vMLFphr2skmltbAj2yHto+/C1qRSHQI0oYJy4xPAK0hBhkBkzKGIDKfqR5fu
+9Rb6jriPwFfrT57/BORRUS2uxaWe/23vw/VDRJUNDKbcoql9hR1STaoUKFJAhAE0
+AZZLjCTR5qxIgYLhyUQktqwQ0LakMUoDZaYvf1dL7/UTZGZSt/h0bF8bOrkShINm
+UC5JVQoULQdWFmExZOwxx6b/nrJEIzcATXe9RX4uAjQuZbT7+8dvCcTe970nE51j
+cmac2WktrRIBr8KKqmFiShChQWsTPnID4M0CSyZe7rltE0/bIvrM+YcPthAH85JJ
+219mY5mjPQZhiZDYZA1DzBlAjUcjXvLL8BABMGVQh/A/vPwUfqX/5kl6UGGJn8FC
+P2GG+QceVRTNvxzts75paBK7NzM7TzVVUzlIqqif8NJKRImR08cg2cHrQWxKYcNh
+OjnHzz+YPyaL9PWNrPR37fFaHr23fpcy+YYGWlsuQf4q7bXFjzjZ66t5DEnZsqLU
+ixYlKiy0ibZsjalZamaizKs1laSpmk2ratltZbWSta0bazUrFJs0ttalazaQUhKg
+lSUAqyQoWSKtotVYtSmoyW220arUsoo1tpLaNtMsmtaaYsVTbS2UtJgram22rCkS
+qQSxISyQS0FSSyM1KaS2laa0lhNFGhYWigRULZFiyykqoCxFBKRFSItCrIUWLKak
+ppY2WbY2tps1pm2ymqbabbLNiZojaZkrFMKZrKzaWVptZtppijZNM2SzKmmxsRab
+LZs2K1NVqWqEzMlJtmqVRjVNZWllSVLM0LNNZpalZokSlltLasJRUqopUpZIElIE
+lkqrYjVi0aSNqWmLKpslJtFRBbSbbMy1KoplRspaNlNUrNUaaak2mpVFTZVGxk2a
+GTSWmzaCpKbNJW2WqWqKMmNk1GkKUtk2ysrLNs2WwyrMqKpqZmmmKxtmqayKZlUk
+qNltKlRSm2StUtbLWxTNUqlspo1ZtltNKRIqGm0tlRtNmmalNGZYybMozNNKkxpI
+2i2ULJqUrGyyxJslNGpZmtNSsrNWZY222yttmrVNTbWZZMms2lllbKstpmrNMUmp
+KqUtptKyaplKbRSbJbLNplZtqM1KKbabU1ZSUAmUaxpZjUkhUmyZmxbRSltNsrMq
+qVbNtslSptEzVrMqaazNpmkqZsxExpJSk1itlWqay1KppYopMUkkkmbLNlMymsxS
+0TKlNjKbA1TLLLU0lTWalTNMilKmys2ZY2mqViUVKSyksmapVNqSJRqxZSyylMlS
+yLFSWRUliWKLJPR487tzxPbvpf6y887/zT6h9UmfSx2PLPXLE2t67TNb+d8616jt
+tPkeNmjOnd2bULjnN/5x19I3dES+7KaAHB8sg9OaIHogcFmowcPkd56v4UKiqJhg
+oAU9AHxYiJSboAuO2tYkauzYowUsXVGVlc0nYOpihEKtGCELstXcQR40ZwxcKms+
+7pFjCoGnlWDFSsNDI2M37zbDfLv3avdlnZZ+BC52UzTjZKLth+XpejoaOcVlvLIp
+Bt0bICZGx12W3MemDI+BEABpXP87P4rJiq/on3ucmKl3H2qkVoDOXeBVIHThRlRW
+oIeneSsFb5P81QBgJOLBARAX3nH8/r/f8w3ilqIGYIs2ETpWjUrVBz3ap+abPKWH
+pLM3ltPx/+N/Wbt1NbzHN6yn49NkVXLjHsi0YsxWYxt0mpP5liJ0D/BK861JPxVJ
+KrrKd1DEsjkf2fd+E1sqc+0G02nKaZP3/wWYV/JKhVSKU/9f2kP+Es6z7k/gUksW
+JYe1an/921pBsrUdXyfSH+6h3N4k/jE5ItS1VTkajSXnZgf5UtgpKk2jaxZibyd4
+83LeR6x6+RPw/T0lWWVLOy4k54wllqVWtTTUvHd5G6VXZwcLVpZCyOySqT/VUqI2
+a3OjB+BJ/c5vJ17xaYezrA2WTu8JipWJ34en5WSThOGGFkqslgxWw1Riyit2TjUk
+4m2SJs+3WFSYNQcR9lN+j4j1noP93VyHCfI7cNMSZzH2ZNRThulseIk/yU5KdXt9
+v7zmbk+gjtO690cSQSoFfmmeBxfI+vqGsirzNH5C+xTw2WGGHE0X+u176U0uLoPT
+OEn+qsbDvaA4s+lX8EqpJzPrH0sloeXR1c9OiqmXer0zgSe5ZrT6ScTDZPxHCbPN
+0R5uo6u07SaTyP+1LS2qfontI4sTqU/nOnq3gQE3PlZlmWZRJYUsqyJ2P6PJ+L5/
+D8Jssqnh8+u+2ca0nxwRAJ32knCcvhmYySY8DlHwPRZOyxVSqrmc5yn+vVN35FkO
+yvNZM/ORPMmjIkxNtLVRf1qQ3ksieqJL38h25PbeROj0cV6GFHWIPN2qxXorv7Oc
+ifauTZXzYwjFM+LPNWr/a58p5xuD9uXn6b8HdXj7TiR9vZIw7HVkmGI8569eqqvk
+P0vhi5cxU9euWvzV52lG6lLCSmYWK8coeiN0jxImMiT1bT9FffylTz7SRs5vwq1O
+E1BPxdk4PSI/RJu9WoSzsTH6v0nJ8nrzi+ITko3SqSvxOJ2nukqKkpNLHec/hfS3
+JEnzWJ39PoktklpWMyyPh/0Tc9E9Kdo5IemeY1NR+smI8T/dPNYrc5nXv9t9sHUa
+mQsqCq1PemmmTVTeR5UqqSopSlKWFOYaL87JVmxycMd8wy5fM2Yw/RXl8vbb5SVb
+u3zORyjjG3DhlMKM111l6sSk+BAMLpSjqdn8I5U+moXwXX5p0Z+Ev8Zh48/wLRnq
+sVOvKupu7tEKFfaNwYH8/Ci1xHTYAbREOEoEoBMbtSSnI7QnHvPpNvIrSaUlVwno
+cA2T6JPxOc9Hjj805OqKqKTKMtvz7PuSa/Ze7Y4TXj0keaMVJIBO6TUtNbu22/rK
+Ik20pV+zX62sR+LTYvA/nP8S/x/z/y/t/m/n/s/ozh/TTT0zNN8l832eeZrP1ft7
+l855ZP0+7P2fht+Mct5xlvGpyPw3YySSq45XU1bSyrab5ycrjjicbfT6o/FPun2h
+kqLVQZw1OrdGyq/AmFG8iUYmGjHDOy2YstLLBnKVZJvoZpv/dskjgWfX0jmmn+XT
+9EpEKhcAUlB/eYz+SbNu4qNSSEC7hItGyfhotsOAf9SwdHA8hOJqR/DyaGA0EVqI
+SKD6AWMbIK+iFwiWZNpCAwgFlSy1TRu/m2NnOmMXFK6UuExRVkRZMoar/6uXRP9P
+7ZP87LZwYx0FWaYU5vlVTqmnh1eev7szJOiq4leaII1cL9t51vM2+LzXlfVqKWyp
+WvCVPQwScjU2St+kOba054lwkpIqTJm2mrtWuoYNioqjXh9ZCcg4fauRyifOQnf6
+SGRSfxqdVrKlWU2qUzZplGsprUmLRsRajVG1FqI0mwhqNsVY0VqNYxgASIkzAhPb
+KKjCrJLVvcYYOJOH+vt9D6MOVhCbzFWO4yRsEfXvzBp0P+0m6q/l61TUNMPwDbP4
+A4ZborpXA29kUhELXpos8r3drnud3G50Si5VJtefj+9ZVvVRlXCz1Xg6KThMk4mm
+/BxViVUbKrUw0nSUxVm8OjGchs/DpN495AGe5+K5OvXzvbUNNMVStZlSc5ucwd3W
+l4u1dm3WlJobdG41bAbKyodIBU0lRgRgW0aw1kwVrIutSyFWNio1Fc3UKqqpRju5
+Aadp5fl5udRTjI1JPdwpAh5+pEn8lE/gwPC4SP7yQ/wfmhzK6WLcLLBfzaejXg5N
+ROtJbDGTLY1NWSMQ3kPP8tNlbsFLO0khJHEnOD8iIBLHY5E5Vaioqq6mHOzViRnO
+TJDV5noj3lYCpbB/UKCPiSPRFBjGEsHZXWOmMUqqoqjVmVmoGFKNXF5UqRqditja
+VqjRtTTJJCSNK2SIBLIlcoL93JoaGmSYppju7taVJZUVshVKnwaD0EH7hMmp/h+o
+Pbiejj/LCXLxi+sY57t+Gq/cILqWSklksgVasVYdKi3aLGlcq4fh/b/0JI17/hz9
+I5p2kpb6oqMezcw1GWkqUylkKqYsxkpUqrKj6ahmlf3ytR/QMwpaUHB8iNiv9K/z
+0K6HAP93CkfDPEO0tLILS0pZtCxDEo+smm6SnpFqPN8mB8k84m6eFkLPr2/b9vvq
+30sMxTJbKbV41vETNRjrYhAm0Kmypb2ozMJGlqo0oyt7s1+ZqRGE5GDhx9HdIoQm
+hH5pdOT8GMwPVn9cd2LOKocJYqpE2fJibmxMRhVjdipjJLKxv8lUwhE3F+9vM/Z+
+96zDku8juRY8ZkygVpQhCSGE5vWjeiSSO8ZFx43qYwI0q4xeFMojCEBoYwhDwpBe
+iHCkNkSihsIJhUNuES4aChQwWFNLDYrSqqVumBhK0xiN2qw02aBvWoQRkbNJJAkj
+HBk/f0jBi0Qj3trasZSWJAABGGhpyETY2mx2GGObpTObWrb351Vt6QURN7vvOMuZ
+MryvV8esvd69S9JGxrTRiEw0k5hoCqjCFy3INRaqNJwakaGEikSrNSYRWTRj019T
+4CORqY4ubfHfS36+r2c6tibQpT7uqxK5TMRXftJ83l0OEKb1aVXy8jZKtwphii1E
+32XPN122+997zbb3qg2rFWEspycmx5fi63iHJ04NMLBsItv9IBqEOmT9g+SGvcbp
++/hdEfGRojRGhaIFKIYxkBlxKkgcNtjbaQ3UpIqYgYoKWc8GtGtpwV4rXQ74tWyW
+WrSqxFk4NRFSeaScu5yP8VExZEm6XE4chWxqNGXXVJkYnR2cdHk8WdGYy2vCmNjq
+ybrMN1FOOcToskqqI6hQJYpkEaNCNn6FTLldFQjIRVoB+utwbXmdbmWEDBprGCfA
+JCZRpKqRYfq2e+7Cq5cNSfueE8nT0BAAmYe3/Q5/hbbwssFCXp+OE9EkGFrg00fG
+yXabHiy3EqpTo/Z9bfo+ZtPrQAuNWcI9+eSwSa/nYd7oXFadmUYi1ukq/ac5AAQE
+7du1t6q7K4YbOHkbtuq8NNGMZw/VibN2MKnJyZJzVzbk8nnizzY8nI5Pu2KrwXrL
+dm6nQ57aXMY8TsVyIDC5bX0WfDw+jTpp6QuEj7W1TMvq8Zyu9vdXFD+nVQXfaj5R
+BRz2fkfnvWnhDIyYKVitWiZZUs64DB3WmYY2xUAXs0Cakm2Wq5otBR1e9IE4xR6I
+UQ1xETvEmN8IlSLEh0Um6u2FSoE1m8LDpW1Hm4TFaGovlKmdEOVumVxam7bCipxu
+T6y5i4+SRHYrzydyzSvjm0vMKixJqmXoTSKKjLRTRkxS7yrSDPFa3nQXLkJi0PGz
+Ue3b6kGdih7KjMMNAjQzQTDB/OKQ8KFuO0yGQmIsJJJLKKGQAQmMosKAsZY1R0kL
+PhQaaKZWN45u7TtPs7uvVu7uqsd2mxpMjs4adWm7k2YxhWGOTRjkw3YppSco2dSD
+nDT6F8LNCzhHRwSHThhZCw/JCkWC0Z4GlllmHQk0JGWItJaemBYmSUfC/CzGtdOZ
+glpafCCzTTeNljGYrTsbK77srM0abuHRsdXENonRVgs/PvuqzvZPJURUwfRVTFTL
+HP5c+u4dT7LGDtNFEMwhcRariKthqTD1vPM95zBVA62rlBLfaioIouD1obsxmY4/
+SLbB1fe/WE5wvNs4XW/dM+pCuTReSLHk06DGF0WkGUHXGlrLY4aDxn3fHt8HuzrJ
+2+aMDPlI78q6bHxj5uF2TCFwbZMGRZ9YDJhIWy5Kgdxy7a9+tDiflePrabvyHDj9
+YiBjKMXYZIRdTNJHAOT6taIRRhwL6k4WH8MdqdOHDZ5XET0kKmF2Bk/gCivPTwLD
+D6OnV3Btj6vA6NAoRYdIDZ/GwT5X5/HRth0F6JgMp8aAo/b8aP0dVD3bWzoGD9jA
+IdGjWJpqFEIwOEjh+nBfY8Pv9ThAfIA+v1W1zDh98+IKpRNs2Kmxah79W223bEUj
+8FgfYebzbUyGl4S8AJvIixBOhDSmA2GYKhWeUS6ADRDvpmoClc1nZxo2BcF8lMAq
+GbIksqALJKpZprIel0G/UM0/NROWO2EHdl8baxjfvVc1Dz9VKlRqHhPwoX/hRooL
+hYtcLETvFJPN1IgE2b15FDZI8kftKHm25vocSMiWe502fv/5wLI7POSTnpHiVNkn
+KN0f5ylSllDaC8/EnNMn8bMOXdHDBEkioNT/Kpjl5T/FSNstpVTGKjCyZJilljk0
+WCJtTbKttU1vQ16RREbZJVRVnrJY8VbpfQ4jCfGExUvOtzOch1jTc+c6fhbzdJ+T
+ZjocHhp7tOTg0hqFHEdpzHf3mFU3tGUGnq9aOgRXwlMPc4oqofnnzkevPke8ocXV
+cWn5KA/wBIoOBRh4tKPhq0owg6MZB0JF0/BAeEjICzw6dNpJCSLZwqAGV7MVmZlz
+FW3GuSbWrY1tbz6cEBX5/031t5Xq26tD0eeTKPanZz5maen48Hmfm+rh8R/tsevt
+95vOVW8muQ0/dwn6qkVSPxsTydUx6UtRVtlfoqMjse8kMZUj0SSye7/KVZXR81mz
+STUJXk04fITUm7Y+EeH1SIBLCfsshViYpJybG/429HOeflhiyJoizZZJqnHAaUfl
+IkvOJH3SKlVJFWbJPqT6ux9pskzdwrJy6NBxBPGkSiqK9nE/6yaHtOaOIlPR5ned
+BwjqrLOVGfdvOzy8zy6OTpB8JJ5O35aTvUnmpOHOTST7q5Tt4SqsKqrKU8ZMLO59
+VefKuttZmLKmGsVuzxJ4xtmOsbzj7jrHOnDaObg2tvZVLY2bG06W4xJ2PRXowWn6
+Q2qskgjIGgwGL/Z/7+qho/gPTXh36jmR1w9demMo4Y8k1PnrL5bLq5qtlHMrhcTx
+qkjHMqVQDGMFtMg0tkKYtmljaZTJIMj9NFIipt2BtNmmpK5MDFVUUwrJvjElbUrM
+i23kbNn7H7hCiP4ZebpITlFV4hhqmRLE7Z94lSPPmM6+HR5PY6k0ntVq21Nlhixw
+sJ52ZHpNNQajs6c9vfpv6ZntOE9LGPhh91dhtbjq2MjZvtil0zo6r+jL2H8eLj18
+yGzWRNcm9I5GokcOjGnDG7SaaFYxVOitW1Wmzf9NOstsnBXsVhrLaczNWymFZQmR
+BAR4hXFLIMn8tE0KNiGlQnWdm5TOjQdS2GXGiCBhAiR3+IuNtczrWRxLegSYOFQ8
+aNwQ5pS1bOmZvMuM2Titbss3zVUdd41y8iQI3cC+BYszD3iyYZAxufkk+P8nXHL9
+uAF6kyiw54eRvOBZOAlO2Jkks3WNzvOHZTF8wXjOnz157FNv8IdeqWn4QqxyMzjd
+ovNzuHBnGNqB8UypLJspmo/PZrnERR2PqVzauvfqDryP7Z+vQD7IISU+56T4JDTE
+q+pP9KlpI+PV4dT1ixJrec504hI0p0ainusxoch3Rf1aTnA9yf8ixfufD/nGTaR+
+r9Yxn56qBqi9vX5hPpZKpLI37GNPZmMfbbfbh2nCcj2D8Z5XfTA5tD/UrkhsSybh
+P3xy2n8vXr3+fHF+jbhrfffrgpMdwyKsEIABftZxWHn6eRPx3H4XyvkzMnSq9ves
+52gWBe8WN0R5UW63ukJQWFQ4oKhAJyCJnQEqDppQlchLgECaszI1WAe5g4MUFyh0
+anCQg4mSNdSo2xtqgYJ+eC6eYyu+bd9QOSufIb1aqsFPuqFWSpbKUpWlKojFKpSj
+ujZZcdbOTOI0xFWRNkIpGoH4pGFJpP3gr/zxFkAWoqElVYP4Gt/X38U271ZrEysV
+o23KuyJZatOZ0Kp4TXVYhqbvrZeRB/cPmRH1kRtuErUZW4UhQwwgBj0NR/V3kMY7
+EobIBcOQukBiqbEGpMmJiq+WZWm2LXZ6qn6+3RY7yG3Jww0zZ0a0T9xZo9U2SMjs
+PDENqfk7N482T5PLSV+d2a1f1eexrCMfZXsuIkyj/nLJDF6pYr8eHJ6TBVV87tmm
+a7bz+ky6PN897u1CATUrOcfrYT7WLUnZUkfzoytVKsFSxI3TkSuWTSN9Jpp5QZrw
+J9vP1+nTbT6eldk/oc3RMOhp4yJZ4IUQxBgmiHJjtlz2GvOHReN9+iGp4Jktksd2
+Fk4SV2/JatrxIFOH9wap6FtHEfVGhB1sDwiGOwtcvTAgVkF6fh/XVVVUQaOqOQog
+5PKIzrA2mJiXdzzLWRbIZCyUxgbN2zVNiK1HWZJuqUsH34W6Tk5MbyVmv9jI2aSL
+I2VKRQpzmQyE8pC1C1EUiox5RWwS9UwZLy63VpJNJfEm63WubJNNHJJO5+RurZhi
+qlWMUlah+7hqpN26aksmYnEl+2jDzy2sWVaxhxo0sy3GKzqg4dVFnqiH/Afo6ZOB
+w6/25A/kKKi+ipEIiyL9rIz61tdfOz5b9tOLlSqe0SxNVPNTFk/XTHSxksktjnfv
+TFaebEYVxUzjImU3vFMtuuFx2WDCnNvkJhZJpZDkrlXW3eZtcuKZcvAedJhwsO8s
+JvKWfGcuMmSVOdMuPtO5iTO25qE9ntOJ7c8nKZfwxh1UZJbaturhTFgc4VklKumu
+lWXlu5AcQCTBIkaKGFUrEV2UU/n8/HpxHWKqpiLFVxDTtu0ZLFI6kEKTsGEUPGDF
+OyKFmi9fCJPgqu54sCIJ6uD6eDlOsdVOSppKzATwfi2t4CPHgfLsRZAITsgfqQ3S
+VryjsJs6HWRGyuXSEjvQFceInojgi66B/Jn9YGev5OSROQPgpDM311czh5pv7QH1
+mjYdG88T0Y6lKoky/ahYfzsf2FLP37iw0iHVc4G1T+qGtRbbYqpbLVXmWjUYsWtd
+3blc3NcosbFotRq1lJaLZLMX+yeAaVGqxZhXrnN4O7p233eKV527HTl3dF67ngUT
+DIWkYklBhCDIYMo0DsbYvZpkT5KZKN0lGEqTdkzEsUySxKGyAtr23/mYGEIYA2ic
+NDzgWF6BTisD+sxSj0YjKCGUBhaU0dbAuSAVMAWdJKS0UVTIyJw03tpPFQtSP5Zb
+pmLpJw4T+ko4c5H5d37d2YZYsw/VekqVFiu6LIkAnOUupHbpVuhXVTePKxVB0bps
+xhwtW3SVTpJP4oliflH2jl+CLI6HIdidSOtEWxPwTYaOFsTDdMOO9lshLUSxbIu5
+uldYJIE/CVEfQGnw3KR8rEXXfhMiZYN1TKw6ox209eLH1yz6Qd55slpUwKmJGhpV
+YEWZi/Z/B+/mfovmdoZ+b+KH47xRdEr1MjJ+9ZGEk8zDzXfoia3VNrVu2HqivcwY
+3Cn7tM3ujFGxSqYs/dy22jfJLV3mNSTmx6I9vwKifsrmelJXD6zmOk4e/y1x5u6N
+kaNqieX17yTTwyGtH46H4Fak1c3Kk5z/ZZaK7PU4mLKJZX6ySfl593p1JU4nVzP4
+uonn80Sf8PxBATaSfrZLZLbUFOifY8b/OQOkPKRJYuHzE80n8kWiVZVKKsiPyj7f
+1czhH4I6GHur5ngfJsPHxaVDwbH4JEAnRdt8Mbc25sbc26WpK369rsq2Jk7ybJJ7
+nc7O76eHpxPLzn7OkGqH8mmR+h6xJVRVTckP3rP/RST+xYn6JzHM8ErZP8IJf7oK
+am6yrFq3COr+Gv1fkE1ZskzBUlfkrr8b8hzk8yxE2fNMfNrmi187J8z+Bmx2Wzuo
+upumHT834f0K/hL3SkSzQ2U85TkrZYbKMVKVsprfbMMsmUWyWP1W3DVjWss1MNMa
+H1WP6OTaGllrnZoiAS6ssfNp5sy3o6d+z1Phfsunc9WPbpmXPm3eqbeJ3nCllcoS
+R9y0sQeiKPWxdMHSL5yAm6DOmnZx9/de80IwLgMAwP8AgoIErJWSGzBhMaRbyCyG
+/KI3YnIr+zatN5zJm9iJx5FlEPllZszjniMMODP1NDhIdNGSUoDpyr2MFiNFAp7m
+dhmsM3rn7xcKDPsQKdNOmEcqRWE10Vn0f5jdKeQdD+sX9BD/gPSY95PtG5r5T0HY
+ruV86045uEMRVSihTsyZa8MesmkTJVlLKqkjBRhG+JG9NNZ4h9alqTnNfxllQNGA
+0GINwKMDY0ZDqh5V+GFsqw2G6lfuxMZjyPPPVzVO+/y341ul3m+NvxltY2IqNsRY
+1tTEiANRtZmKiypqJVJKtpSltTk/sPm7/O/dRNKm7YOQYxq6uWOcR7KE3fYnBOUc
+rZ8tbxGpQnw+T1h+E9UnrJ+6E4e77/fdEqziI7b4QxqWvgPVY2JuUihvCTzqWzax
+J8k0/ueZNn2cHv/723l7vkvl321HbIYegUM+f6eVz7iFR6+P17uMwF+AHuHwfOrG
+7J7tnlJLoqxiJZp7OkanzOMm8/JPR9k3N9px0iV2kiN/2MZWOp+Dmehw93hD9FiR
+9EvPnH5sfKX5VzOWREnZyUU+va6YuauVpl1jSzGGKqpqKIOVA2BEIIMpS3xoVbiJ
+DZ+4+ep9reEaqbrqJ9X9jOrrvJSr+/C3LCqZIomMTTGl5droWwvUnqT7fVasJ7Q3
+Vdshbp9jH8pBJ6bD2U+Cd/hZbX9ay6kU8KxTu8ttbZlm1Zpptjy1hjMVabYxkKUR
+gyjKMrbFpVVpilVWFxd4lsXb8MOW7fVipDJxhwVyRmzTVLLxkzco2dz5NnmsjnxG
+SQ0xLOUGItVGqYkjaPOd1ixXJ8pvAbHrxPhNAgJ168Kvepi5THZi1Orm5ld4ad8r
+162e8Lnx2rLKuWUXYSACKn+0Q+UPkiWkUT/jy4+mbc//nw1tlzru26a16nw/ipmj
+oukAwgMmggdSKdGbGU/Iprgvjn77Ct2WhTTOcy5KZMORZMZRWwQ6QquGZW1JTVlg
+QmM8osKKGDGMJIGMIBsiwhShSkqxMPy+3NPLDrbgVBbDqzyCBgWZKJrEQiRzR54q
+wia4gUepCJo2SzrcVXl3bH+sTOvr0qFHlmMYpGEQaiFZjEgQmdarIu7T2kdmRlAF
+SkKsnConJTZVYwmzOAdnDjWUlQbpLqEmzOttyWq429ehDBlMRRpyaUji5o2uW/LZ
+8wQgAFSMYB0Wdnuk9X8nH0naSH9JI+g9o2Gzu5nUVw9VrujeRN048OjNoP8LOjhS
+uG/rTtFPk8g307qhpyc48W4wop6dLpbpG62VarE1XE8iOyVK9ztXvOYw0JoSwJZJ
+Ftfft+V8JibSreNomUqaifeYC3fJ5fCnZQIMR8DDQUIxtbZGzGjKKNDyRspoqZqZ
+ossZ6UUDMFZKUgwYwsMaaYqaYrCr66wtypjY2abpVSX/mXeSNkaJPqgQhw2mmMjH
+EHymdzJLzYsvmuuvVbsqy6m7aYqyZnGoerqj3UePiyIVZIoqKthYOZ6vGFsYpWJz
+5ns4SY/yi4BSSyktv0dXbf1b1fl9fp9+36YjGvdRRMDFkx6Pp9wzFt1H2f0Y5CMb
+VjGyUszErxN3k9ks0S1Zk8IeitT1VrI3R37ye53Th502X+9254a+co8o7nMnWdCi
+wosHYmvktSVSyC6P4FSTb4evj8e+aNQ/gr3by2tmlU3bI5CjjaesCuuOTInFMxR6
+BGGiWW1NjQqsYxKUlU0qtak2QF9FdGkKOPTjiqoqd6H0PuA+KaOAwX65yfbt0Uu2
+t+9+OvxwswtdK+Z6T46z9ur6JavYqrVySsYUxinbay2mTZRVK1bWMy8Hm/TRaetZ
+W+L6HJ1GI7KbTEnokj3nzVNViyloqqryY4aU20msYtW5mTfBtWDH/fMFA6MUxGMR
+NFAuSNrZk1GrtLMg2RpFCqVUaUsYRZMiN2Nim9bnyPI1L5d7amo7nk142ZMm73SJ
+/eoPU902bpY5T5yQ6ffJkrLbKvs844reynK6fNsroOIGSOqTdhDZO0IlkpYiq6Oz
+Fkc0U/fPTYvU9bxWXZeLi5F902sZZU2ysGSmlVu0qcXTGyX5KS21VKrYw87pVnOc
+iN204sTwOM8R5cJLXpE8sT3gdCaTqejSJPFnanubqkqvQ5+EkEjrFki/syRPSKqx
+ixHNf1x69+Xp6t6l5LGF8d0xI7umlRgxkIYgsKQGahBGMdwkbbIclCjg2oW00iZA
+hDSVAoDGhqhIDTC4UGjDNVSwINaWT7/c+6B936RGV91beaH+tFpClUqVar6a57xS
+1YsdOxwxj98iTq3teHw5yT2NnV6Ms+s+NR8b24bKw/NWKKqqZhiqnM8QftpfQb+C
+Vs3lZLSSASqcfM7yVxGYledbnrN50XJBATYaCsBtFYJlZR2SKwb21+jqRiNFI0Sa
+rSjgiATZnWelW7O0mbziCfju7ylzo7WSqylsYp0JpjJU0qaMlJUUVhGilWTZudCx
+M+kc+l5uTSG84qLYv2ZJMli2qrILI2Tqln4cMqNhAj4gogAncslWOiwaV+BwnPnE
+jdp7E6UlqPtYJYV9Tg3WI95FkO6beZO8nlbeyYVc7od2tLylZPKLTp1I35t2iLsk
+ipSBQqtbUX19H2kWD8z2PyVPmh9rLUcrDSKQsTJIfukqY7Hl5DzdPLdUqq1+LJp5
+emzvHWPLN9YtWeh+2WzylkbFNlTCyVWKZpKyQ4YwqnWq3kKzCwje4lWdzTuDbTZx
+x4bJ8tzHGu7m3prWSakaVZncMwY02dcu7kznctvM5MknBXCmwVtKfU0xWphkowpi
+VsxiVW7I2rWqtRhwpcXDoaZN1MN6tYlKrh3GpWUlJLvXd43OuslSWQ0fVcxqeL+B
+Xv1rpQyBqdm7e1Ra8loulyubVzbXOGoNVpN1/mjcbxaAiUP6xnhT7z2IJaTCQVgt
+DpQcGFJgWSBTA5batqKV5l3ruu7XC3NyZRFeT486vWm68lRqMyRNpSzSpsi1KyzL
+GmTS2azSVMZqtq2bay1a0raVmmyq2yqikIVCwBSIqSpJJKsVBYgSKsBLSopRkS2t
+tKmrVKmA1rSpZU2JTWWSGtUtmsrMWKVLLVRCkSkEqQS0GpKlKZllNtK0WFGTNpZY
+2lmmZKZLbWbabW0ttZTSTFMklmzbbTaajUNZaVNKzWaipYqKmU2mMk2lilaVplhZ
+MykpmlSwamzZsrUtUJCNs2xE2zWbLJpmmmlSyzaYzNqWpssspZTaqtm1VbJlmm01
+kzUtDKks1LIK020pKUpNRlKTSlmUprKzRSmk1NTZZJrNhJIZMlSpNJDMktbNVDEs
+mpKFKVJtllm0ps2WzabGsbM2aQtmsJaMkNaVJmssNbZtbMprNYqWVKlaTUapJmGz
+RClCZhpmEmZpEympqWZmWbRs0SaY0lNTU2lqbLNtts1tsrNtKqSWmGWWW0tZrNiG
+Uy2ylLU2jJWUySmlNmpspWFKJrTVkE1lJmakWTZmUtpS0rKyqpVsilmsNrWWbLMq
+aVLFlNmazabZtNppoZJEkxlJIlplYbNUMaaVKhIUylmxaWkEslm2WoAZmYGmm02k
+mZ9vNcym/zYZ1m/E+UySfg39LUVVWb+0CAnu+IVnzkTYexs7ufDm0VjDZ7mmLPDC
+jvRkCK4NH4KYIPfTEsxAJVJTCY4MNNqKqTgrJkmjRkVkyN9MMuNskxW0mmjTSlSs
+RiUzxDKZmvWVXm9Y8a6VLqbbWXtSMLsZGTNoSqYkyYjI2VEskoLRRUbRRsbWkqSt
+Sau0WgopMsq6V0SZehQ82kyxbJsqq2k6xbaqqpy8chxElkKVybMPBqa1jIGLJqNa
+WSNnw5w5rJRVJ8pXQahwWUzyp0wnz/U0hIEiEYfzEVFZGtr8GqLFqNUUa0pVZVFV
+lLVsEy7VF1qILVeGEk2aS+WJki7F2pqD7InRyG/WjNbxTzY7E029eTdr/1ZJlhzx
+xZEk7TYxZI2Vk4yI8WLZEUcfOpyzjm2I50sicpFjzHRZKelYLMxipnrpolbK2wP3
+Gj5QrZ3mE7dW70dJN3aTWPvGzFnLOYscQkecNk/KdSbVattW/g8tatRJ9BbaVmTU
+cNkbE5NiRgCjqJjBFYYMQEpXT39BIxlLWwvLhFGpGWUqKViqxkcZkznhqQLSNrGQ
+hBUdGYxN2kbWNpAzdTVXSs46S3TNK5yd26mxXO7tXNdm0m6bRbSTJvK6rpKW2TFt
+vPLvJbNaSixoxKyEmNk0kWK0SdjZs2NohYnAsejhFowruXCQlUVFqVGpE0UGZIZE
+c3lktTo03a6N+EiflSdFScJJ0xKRxN5+ZDlCLZB9FWySZUtkhL9OWNS5Kx7HmGk3
+Zm+vn/kuSquatyCwYtGGhIxpQKVBh9sws7qnJ2thu+NtlbJbljpdXFmFp6I0cN3V
+hW7RqTNacWNJ80k/pbIVr82CR/iVzKp1fJPyjz7u0PGnOl53LbDvYakR0ZJD8qm5
+9mWLpEWRzhu+1n9OUKT1kn8VOh3p4lv5ZjCqf3P82pWjKmxUzVvxpOH8eDZPhDwf
+ii4JZZPcJ67Ts94+JJ8JN6n2RXJ/iPpDEN5uehqR3Yxju2bXbGDrRv6T0R5vdxJO
+R2mD+4dUjVjZFQf6RFZJ8rFskqu7VMy3EjDuzE2K5wH1nnG971lZjE1GMMpMLzVo
+tmMJoN2gv8yApnCpgihcVoiUFH+c9nnbz+momOTD2WTT5sRko0skZYttki1bLSVY
+mmMY0wqhWnGhdSllSSW9z4amEW8VfPq+6qyaeu2jZNvXtEl6ptryvUoxwqtXN1Fm
+Yqyc7Jqlsb2TXkulki/galjcAwqxIxJEkIZjxWvohjDLbjDg3VHCdKtlCUmTvHq1
+g1bKsb1nufaqpD0uQWNon9Cdrrb3LTMlSbUTSbK0ohajIvgjH+99Bt8p3n6qleSV
+ZE6o9h2eHZRzpwc3OYmK009E9R328jxMbJvFH6StQnM1NNmLDBWdD/DwdQc+bD7v
+Uoz8D4pQaY3jgmo4UpCiqrGzZpNbC5h/TXGpNqn1Vaok4ZPk4KphiwyWJy5ZHRwf
+oiZC34h6SrVlWif7FRHs1+Nuh+L5Hs6k7WWyNKyald2mpMaNp8+jr5z3H5HpDpU/
+yqPXPAk91O6UFo2PK2u5jy7lWy35Kw+iPIqfOySOpNDJ1k4nqsilXhkeZbW8c56z
+Rx1kbkR1nBpJ1VUPWotkR0rdsQsexSuL+5pk+Mk2l/i7Oi6XGwkvE5JyD6Ifc0l8
+iIBO6c0DixXt8Wk0H6+6WxFliWWWhO5P1UUsfx/o/JZJ9iprtPkmjEsfWdqnbtat
+q24OckqqqnQw+6k7EfBZHMentbUafUcOiqVVVYFUlFKKqejEY6Y+lfo+ubdLJdCu
+RFXLgVQwrGW3GIYJWGCYwwtWWlUskYxZ+emKaZHyQfWMWTUkP9FV7wTx+WRVUrZI
+0/KPlYWlUqaINRpIxmMlMfoeftr+7+JP2H69M/jD8xaKRKgSrdibLHI0VxjbdHGN
+jQd0aMDA0QIQWEpTRDGZrq3R00OH8GFjuAD9iwhU2MP6wiGD+jp0Ymd06Ksv5piO
+Uq1rMkwZkiw2SmZIUHD5pP5P1qcNmkgD9vum0hi+X4S/PJ3/mfi9rbspyye2Fk1Y
+tSqo+5O33q0nAeTHbg7lc2zBxS2K2xjL/dLmkWZGHQNxp9NkyrGxuvp9akHp3+A3
+ROSdXUb1air5yyvdI8km6PrIgEskaR1ceOmv5q4dpNp4dofKup3NzUTxsvxlZbZ/
+V7KshwsVcSqwxapT6487uYnOE9IdPT5DshyR8GTg8yZIxO7D2Xoe8wbPD2vkrki1
+J6oe6xXDYppjTbDezUkdjZXVjE75bVWXRUdldu05D4OvVbD8SxVZLZ009nJEkSTN
+7Y8kpPWH5pUvT49iIMA9AfIDJEZQpYI0oY5HlZOHxMMSe9WuihVMpamSnEH4RE9Z
+aWlkKsWrVSPdFT2zJGJOHBVlVUrpTJRywuMlV0T9myzARkClqiJX70kgpcYzsakR
+kiRXw/k/H9sfrouz/j/oVDN7/u1hxCRIRZULOfq+KvHsxm1M2jkhY7WeUc1j/ARD
+X9g55b0y0OAkCC5cP+IWkuBkJyInN3reK6uz5oJ3cmh5kk5SOROSWbV3cz6GtQbZ
+KFKWuNFtiyrDpfLMzGSYWFVpVVZYebEEsBqBXBsjMbarG2x/fZQ+jLYbHHqNwzdK
+EarMZjYxuuOPbI9sySN6HDIRKMbSRBlKUoJjSMbaV15eryvBqvJXDYi8l107GrKu
+rrePql/G999PfuvQQNubc1orFGJnz9/3e/n38NvhXHdrlX0hVyULe2vF4tSELMby
+nXaVdIyzVzptzbpG0kYyrYmUstRUilMV6qhiUaXUqU2t22sqVUgIrrtLQ1QdExSK
+lSKNIKNDYBCEhONtcvec081daISsVrnNwhsmVFh9UnkeSpU/Ucu0cHJG1Tws6MbG
+5/FVq2qhSlIpMbqkdPrfnJsRP5LJP3kl8j+YotqNDkj+2rYWxbJPER5OzzamSJYm
+ofxdXtOqPt84dU9J+/4gPBe8BUHiJMP6uXrNpwqwttVSaxGF+jEifCpFfxSkr9mc
+32c3S3Szbd2ZoiFIb5ZGYtnEkdJ+Try/CPL9Mi5mMdh+Ug/lZFsslk+ZJ6Es33Tm
+ZHKzR+qo+jHqk0bPR7vVXJrn+XaeaslpRZLB6fWTy0fm4NJO9fzVkjpKW2+cmMea
+KKivw3yNm0nsxo0qY/JPx9o926TeJg2Itr4mV3UibG6zyzGVVRZRZzUmJYrYjeJP
+tG57vdmClZ7rv1y8228aKmVl6+qvZfKRcLOG6ldOqd/Vu6vnzdTvHSaWdJCUkjhk
+kn7Gk+eiZHzRJjshqSwqyDyZ80X6SPqx722PQanWebyOhb9n7djstjZ4dY2OQxL8
+hdS7hgfQ+5CDkj7o7K4g5yNpyOpPqRywlpQRSDKSubGQjFYyaHIAwiqRam0sMSLC
+sJviL0yJ2OkeKEslhZYLLIdXuqTrJIqKaZP1acJCcH4eh1+kfB93b1WTnIpa+SDt
+JnSUSfEhNliaKTnK6bk2NUtOpwxwxVUbNmx5x8lIqppySP7fkeJPkfA/GZNlaB85
+U/xOGz7nG7VxLbFvOJRc267dY5TS32y82q967Sok5Aw3FStphVLMYoq5nJ05S7XG
+3bTWXLtislaIjwcKpUlVZ5bNl3MjhW/1ibOUVX6bGO9ltr3qNM4ZOuTmdlJHaTrd
+opbJmZI0WRqsr4Q/tfrZ3oi2RVBaIqi1MzEkmVJ0pnG2r43k6qGCL9Kkpczv4SeP
+sFeTIEBc3DtAZcH6XxGW7Yaw+DznoSqyrouIMcMHbjD/FBny/X179rvtjikQCcgQ
+E4HS222zVI+KD/aP1IS0pJSBYzn2USdPSTTu868arlGQodZ/tyxVyU5RrlBdEqjR
++4KCHQDi6aQjlScf+T5kjee1Xoxo/SOOyTCd1xDlX+YN/MVvtOj2tXZXckMqqZHZ
+EKEQlkdnL7Jdydlgmev89uU78j5cSJ/l8dkmE7rhzD8qadHMH4jZj3nDGPdwajh7
+sMdnVu5ujXXl+T1/u4LOHgw0+z8FGBY2M89iIokYQvh0gpDsMgXC5N6MMVWqIDKF
+k7Bhi7LCa12ZnoYVi5gcGP9X5TyVn5jjpmK38e0H0yNy9sy6krJx2NyXEkufYjPY
+35HJdzHaIWeWpGch1C2GpaeIIyAyJiVK/Gotmvs6vH4XixysdNfO67ZuafPse3Xt
+czmeH1mHV6i2qvNHrsuyeFJj1OGjd4Zq4YLjGTExlUsVV/xcbG0nNuxlxTLllUUB
+hE0vYrX0AxuvoyLWYktLUDBX8H5cYsLkOfeXyz9A4QbZ7J00FTnG94VNve5NkYen
+LptnR61av5SHOPZVdEI2fk5/k3VxOX5PckzZv1ec8TchyRzOOqs5zOUkm0wWPJVW
+TC1sxMVVTWOfpWxnsx/JmyBRsFWNsiIqoVUFReZrK80s5jqpOqvOS43zEuyOx1cp
+0Y8OhOW7ME8lk6LCeFLjEsFSqpSyelXJhXAcdpsp0Y6/OqpWhUMVm2xjyTgU6nrw
+6yszFUttktLZVtnXi3kuDRtDz/sJ5OxXV22LVZKMYxihA2Q/Dq/NjZ+535t7PF0a
+3E6sM0t90PBzJHT5SRrz+MtSHquWXGSMc07ChTvJ7sjSm49U8JK0NlKrXIMbnnPC
+0qUqjU5Jxyt7ynN5e/kM7y2YxjGrVeTE5xqbVT8LiY6bpo+ZdRG82/fr1m22xZSB
+38PxIyNMShQiH6G9hXLOZK6w3N5+X72HFAxu5NSfRpW6afRXqo8VJGH9x5ObPuVJ
+QLAiFlH6/u/FbMJ3EnnDq7T0En449m8JHNPxcyzXSV7BCP9JENSIjTahAiKfMpQX
+fhvwg6xjTyfA09UakjGjZSMkcm0k69uDQkz5aTWCW2iz7hlcSciTjD3IoFZBYmNt
+odoFMMIkDWQjASGk0NA76DcIySAGLYwAZPQkVbS9raOCXx0N4NPJAcpTE24YEIYy
+g7CfLWmi2E1TDcjdkTMXE0qKsqvYI1Rc1zUWKjBt3dZMYLSc1V8teNrSwW867u67
+u3XWz3uiTDJ7uup6aktGEa9d1hTNubvV2q883d3IoqVnZHRyRZT547K2nlbs57pm
+7cLQoYwF2iZPBBH+5LQ7dYkkhI6u5sNK9nPxux2bnayrYrkTq+u7erJbBUNziMaP
+rppVcY3SxyySyySfFXkjZSuA61FVMKi5jFHB+UxNKWOqcRzfOSQki42nkQs97JyK
+5amm58SFk3LVSU0uj7SQfqwEfho1r92H6uG22K2lVz+Uf5sqP0dLN/GejmK0sxrP
+xz1m2/05yx4ONjCbJH9A+8QkhIqoJKiRIQWkkRKAK20HGfR9lFGh2vmzMyyCig/w
+mlAinByNccszHu826vNs08OjdXU3GzSpwG2/sZ6SHoyTSVw0slcGjSBnq4UMw08I
+tvw4uHqDA/w6OSCRnyIh/MH46rxmTFxdHacVc+uD3HvflqHvL7RI7e5edJqb4ZU4
+09uYztwe+W/IpAaOoyLcwQVPk3k69Fffn6zXZ3kION0cYOXDuS+3vzTOm/K7Mq6H
+OlZUd7Pxxdl9t69NorsK6eU6442+am88vu73UsgRoV5Z211tTDr33RPyM6/XfL5U
+EDhtlOMGIOhqVFDMLDExeDQGHON0fZdtpnTpZ6cD6JBkGJpUx0Y0WuppUjCvDGzH
+Jsmjd0VyNNnRZ1Y1MNHaMbOGzcp3VttssZwsk0gsTGWj6gLXG8FJpoGGjp6NmZZI
+mQYvcYoaIEFW2vkM2ui4SWaSMLtv6RnW2Q1A4FIHgMRpRK4eNjfwZ5oqGaaSMo5b
+dknhw4SbOELPGyXLyqGoGSSqSomY1HBBVkQqys9MCWL1YjTEvrT/lW/HvnSpG2HG
+W0YwPtoufZQEsPWkFdi4q6Bs3tkoppX5Eiaqo5JX1UtH2/gzrxnmXNzE5gfF8iGh
+wMagId9OeGfjPxGKTtKHVVJ7vT6eMIaVB+wH3n3+jxV4Svh6l0hS2vo/Hxp46W8T
+mStcsHMrio8lNypolKYqrT5AyFDChtZGHuINKBspBGKg7kJt6Bo8fNBswFHISJJt
+PcLdHk1+NWshZCgqnMZITrDX2VnDFGhCe+9um2kaWy3BLFDrBte5ISqMa3whRNX2
+hdsSnCgdmnJiwaaFmqxgEhoSkmS4W5nnc2pOkjMCi0Pn4WGjUumeTCfLJJ1jYrHx
+jaFRrCj5qXWxkTinm7fk9Hu2JvELPk8MMVKpWKtKq1iVVKKUxXlx31G9Tw/vO6Mb
+E80lYmSJp0FRrDJyLJ51U9ZI6GiLTUsTlnZqBqxHcOldSSip2iosJI2Ehx0kHxDZ
+/AZNzYUGDTXrMplachkVuS1tsiYIYyt2mzZDErJJWTTEalrQplZC7YM+li2SUoxV
+VZY0yZkycNIiDcCJMaGNe5kXBpN+8HIUgoKqYnY1JISR6tshCE6JhknVjg6cMhWn
+JNlbSdppsotV9zG202HYjiEnmTz+E7xXhSrLv5ZtdazVbW2hjEYNKDGEBkJ9/vy+
+vnrFURs1YvpvLuyE245w0VLL1kr7cOg/Ba/Qf0QM8JPxZLLOStL5KZ+faXr7LE9j
+17oH4+OiR8orIu4h/RAagtxGICYpOWtBCN8eXMu7rl485VKQmKi+aU6rwbyfLXpr
+161+qbettfqWN0pL88tJbgpKWur4a8ki2arIszGhZJVK03h6o84nieE+RSDA2EJn
+ygppzrRHjjDHHjQ3oAGNIa0QIJjBiGd8s3glSnsMZSEY1I4BqCBOrFtgXZ7YoGff
+5SOeYkWToVOR6a7/Dmyl7pPebOTUlLEYebR5Ikzr5O+azEJXRy731dGOXtcW5mTx
+HG7GnHVxIbSbnuyUslYdMltVhpO7tytjo3Cx2IyGZDKmmWOxCaYRisSq0VhSVpit
+JWkrS3VY0DcaigxKkRFVBNRkkg1UhOMurldw8knJjznZobpJOCnNMtmM9JI/gses
+Dl0es/T0c4b+aSO5yy8it57PtER7yQ49svq6K2KoqVhjFUqmm02P9rP+enbyTaJy
+k7zyB5VdEyRHyqE2jlT/N+4jPJHNVfOPajFtvo+bRIhxDIiAREIBEBHmAseJvCKp
+aWSr3OREAnaST8LJp9TClbcGN022eOxs0mObY5x+f0+u0ck5RKKUopJrgB87bebv
+yv5u7W3q/fvzQ+JGypskPUreRLIrmybatMsX0a/RksaxtIKIX8sn739qsebzOZiG
+by7s3vdaJR6Dj2macG0WSRT7SDN9KC4xmGSRgRYwaf7MbwGIOPrP6Rb8N/DY1I1H
+JIkrMaQbxJHdIbifDkh15l2d27BHRHVPKch+6RBzeUnBMtctc4pKUyuu2upJrlrq
+667pW6+1t+6Vk20JkkpYV59A5unxbofu3vn21Ey/s+HYx9zasPu1JNm5an1x85Hp
+GG1LFk0RAJ1kfSK+E9UPntJMsjrKWnc/YuFg5pe8Oyx5qIpZEbwKh7e7yTBhymws
+JtGzb8PDzkfvPfLZJ5yR/o9pH2H9KqdtVVX7VbbWI2Nmr22lllliKehVTXVI09Cd
+Z/Ou/e1aKs8lfvPiSD3/Bks8PeYcuVmGgTKW2WyVY/isZRxJN2T4vyfP0vRyfZZK
+rbaZNZsTidKX8ofEcnunxzNEJWu9xbuQ3w1er3T4Y3g7/gteJ4WVbTtmn85O7lJ/
+VEnkTJ9atqsYYYeujDUxIwoxR56sknNj7SbuGneRs8nq4fJO2cpuiWKioslVKlRS
+pJZ/ULtdlKi0b+Z81+yixKtJIPDdvJ+LvDu0SyY/h7/w/FiNs+mias1cSpOznIPK
+yrHt1CY942YTzH+yrZIoqhOEiZIT845d3T6Pps/6Ofl4bEm9vIZB/UJBbEtgRgyB
+QrgTP96/o80lj8FrpZ3WuiX6brraSSqxRuxjTFUbWarrGGKMDbBcSioFSqf3ZLaC
+XBlKqfB9CZLWcmutdlVXXxEzqHZVo2a5uZjrbE5X5CvSKi2WpbDaOR0OqaV2Vjxq
+myEND13YGGgTBqRBqAkgipVktsk1bJm28lu2ll5dkUpklpVLKkqjThs7SaJqeWRG
+VasWSxZLZu4aIgE5GtmzUkyWRexTG+WO1qi40I7X+GXLi6g1d5IU5Kydn5ZoeE4k
+iNK7HJJHZ32hk/RzVTRzKwrOelrcXxZCb6V8ambb6i+3z7g8vV7o2qRK3bNfx+d9
+az5ZypWyvNOJkq2zTDGW3I2kxsrRVg0qaU6NmxvJVssZPf5Ch3jJZiNskkJC5thW
+jziKca5yYTlK0RAJy2l5f1mHrY2Dc6OkI2TTTy2TGVsRATPxGssjZRlnpIg3iSRi
+xI5OR2SOZJPl5/ncvR8vln1Y/uaaeTGFSl5VO11Z1vnvja5W9Kw09ahkgtDDYyAY
+Qw/WRKMp5aFVusKrZpjSKdZ3v58tazxmJb6NXQlD2AabBtG1MLD6P6xKQChW0XsB
+77Y5z/JBkkMXpKgXiWquYcP3Pv6+I4oBI7HediIrxI/Ei95EsFOQPxkk78pP8rbI
+tJ+v+lu6eiHk6+Kqz+L5PSR4npITj7fgsgl+q1VWGLPweJJjUnC/Grtc/J2G01ZT
+LW5ObQ+bnkr8xJ/5P/vSSP+C1jG1YK0Y1sao1qoiqxtFbG1bFRtUa1sVo1trGrG1
+RZKNo0UFSilTNtRtGjYIEClGbbBQhUJBpCDY1o0bFbGCxY1MoNG2zTaLUEKzFBMN
+tUbFY2iqKIjEUlZKixqNsW0UY22i2g0agirFbYrFtJiNJbSao1sWMUUUUbWNslpL
+WNjajFopFMhJGxRRttjbBtYNtoo0YrRqAKKLUkmqi2sSVY2oNFaNotsVoyQVaNGo
+o2ooqxaNUUbFQoYQ1o1WLUG2xVgybYtGtFRgmVk1iqZFQlJrG1sbWTajRaLFaTUU
+VRtSW0bVFWxasFWIsVosatiqii1GLaNaNGpINqg2jVoihmxFti2DGqiqNFrFslti
+qMZJm2sYTbGLaiKiNYrRRGsbWLbQWoi0WNGo21irG2RMpRo1GK2Koo1ii1i22C1i
+1RqA2o2jbRRjWi1jatG0lUBWzNUWo2xpRTRVG1G1Ftii2pLWTahQqKi1otitJqNU
+lGjJNKqI0Rq2i2yaxjbRqMUVYjQaKwVRtFjWiCyFiKsRbUWiosmsaiqjY22iqLQb
+X5/99f4p/uUf0tf5/9K/qseg/3/8O3Ejr31kY1gc5A1pvXCxCkNiwvOQZYLITeUx
+5CNobGwqJ5o3bWtQ2oqajkZRrRj1prYW5TG2RkzhxibIud1zezbDrRBn8s2xsbHZ
+Ilaaujw873Rttris4cJCx42DgiHZM67LEm5mczQU0zdbGxtvENm4RY8axrs0rvvB
+2Lmhu9ZH1rnXlfnhQMwstTWMgZ24VXZJdzdKmphdlKOvHF5Ypc1co3WpPG5UchDH
+HthGXu6jHcIFa8oQrWt53ErY2jQyDFGQGaaj15BbvaLTDPKU2xY9Mj2zrW2Hba2J
+jEwZb1mshmPWcZdXPGGDOQ4hqWsZbxqyLQ6ysx+Pu9UmOHJEyavWvHjbPPnsX1XI
+iq+W3w8Tu+Ry16Js2+QVNGKUjZLWwXGBxtiE2hFTSXGBGkBjMu6xtIYNFQM1yBbp
+9u0ksTStorHkolJ3E5XN5tOFjhjhwmVcOxEtLHxyyr7N9lk1DJaN0qwpiCBpBAPG
+3V0ccPvd0Avs82rSKmAnj7RQAdYSdYbzJjI4URnJfO3TT4xQ26ahpseRDUtS+MKb
+aVjQ9wg3lnedmecmuQV2y44ptKaHyuZcF1u1JXKJlu6pRPSTudsbp5qixXfWcnpx
+PboouIu6q3vjI6ci2PuVosvF0bH3kaaLyFWNsiaLGxxWqGnvHH4d8MyQpjfcyGZA
+6+PHVbTd22SxshNhjBvMiBiocsG2M5zFRj1yyQh5C7vZX53zDy85X19hw6XAhSc4
+4HRB2w2Jzqalk90qqeRM9JrLjIlc2+tvhMyT2eUuq4MdumMqyCenJRHTk1OZudfS
++VfKOcyA5HHezeQrJxq2piOM5vIJjY0fYvMt9eOLt3WsvDtG97S85zOs8DAjs7dX
+vmFFxB5l4hvFFWKjG6TIUmyWmMme3cQzNyatha2CUx7UUluGUDYW7GzYGPvUZVUN
+2QruGNDbQ2NtNsoEDGs5S4Sw7tuXObFDTJmQpdzuUSm7gDGi7IElwyNbNWUW5apw
+r1xMC2oS5tUYZA2cHGiAzve7XardJ2IuYysvZR0Ku5Ck+2RL65bzSHlFlxDxNMK5
+TWUzcfeFomjrOXGkuCogWNpZb5Tmyes2YdxqRBmU6GoIV0TPJNojDDaqLiTC92lI
+44VORRdd7f/n2zez072fHsVc0lJBrBTJO0dTCCHBnnJ7l4TDb0xvuQrWjqhowcNm
+KETZaeWn2MKO9JNMjipkZF31GWlSxcYpJydb5hSnINMGPuEOnRLL4UV1hvIPGKBl
+ZvS4ydl0W3uRzvMAxgqY2gIYc5EjKevtHG5vkRZfTi704pm64VOlm9mnddnhX1d8
+i11nlLfO43hvIUvkhnaDTed1UYzb4SQy8iOZJY0OXGtwdkbrl6UMLqQoOxj6wqcm
+67PRzUcwOOdgLJgvlpWuyLe1MNGlSR9cdZItEm9xaWRy5l21raQcOMenbGPjUtId
+5L5rfXWQr2NbGd5BXI6+tVcA2rcJgTsa6HJhyR9JZrTaSuTN7tG94c7fN54bJ5gK
+AteSmybgHEB3lSGHTGcmecrPGjWNw+WA2uNR0erioM73usN6veTkgxmQtzC+7W1C
+52SQlmXcODt80oUQQutphmedzHoa0Pb5uGiUik1kXE7ZGybH16ydOZNOpe5Sgesh
+jsIhgWSTnObvd7JYyX1O5WwQQTtFWii2tYujUsWbw0ezmrTNw5aVPbIMBpLsctzL
+3e82boiMG5yOnOmm8fMsldyWw025uHyFFYaQ8uhZTsWKiNp8JA35OM6ztkc5IRzb
+yi5eshOO7RfQUENxDrF3qvnKutTq2OI2Axlgzi73va5to5kVtHbQ7Y32Dd1k3HCj
+LIPSN73VuOclVLYXpmseBJzbNvLSDWByI7kReScm2jiac6ztXZGkbaiCAyO2QzIX
+Td7J06xss3ieAXL4jMoKMHsszhnY2tu+PYncmERURzYjb7rVmXU5FSXuzzzvke8r
+flq8UMwGzmKayKZkWIVa8gdUzJzlgqDkEC5XJt6MpysuebzMk5crS96OkqQR3Dkz
+ElgmcLoCwfLTbkIR3GXy81m+S4PlrND69sIGpuN6O4g2ktmwgkuHKu9wyznIiYqH
+xh287t87BEPFkERt85JvWK2OrjtJEX2u3Obs84debd0rw7zdeXMFzOZDJ3NvLmvO
+W98l52eec8Ovx3URCkNEx+BY1uglDVhy3y0UPJcKyiDZjGbewQ+bM3Edm6FJOvzz
+azuclkGaGMcYNlfJEmxcZb4M0d5vObBOO3PN5hD0onSZ5O7GGzFbRbOZzlE2Rhka
+wphx0zrlixjRccimW65Ok1uZQ8tkA7rSLGbUGzJIZew32hAFkPnNVhE9MqWiOw47
+zozjty6kNk1N83UI0ZAZmzwzHu5NUqQyQow0vktdqtUDtNuQOWVDBrlBzZMzs4tf
+bbgLjvOVlw1POknTok9nX1y1i108eGb3lqIbyXdFm5ZQ1N1rdRtQsbwYcJmHBeXW
+2qMDeacg55NcqOxlx5mVneeFYjRYeJ0ckbFCkO9HPGh6Uz0YirAec3cAaT2SN9TI
+dhI4eu6xRjeuwlnHtcd9I6I7mnNQujxohaKtvuAQd6d17CIoMjnTcYTJ0gzDnLog
+y87zLa4RIWrjb3QJV4OaRG3hmhxMjBaozkkzdTcUbRtJzGncsju30dDubirvs7xZ
+JuXdqYd7zsWQFdt5eUcWbvOEb3hdO1zObnI7UeWd7m7t8zw5eWdMmpq9lvkl1O2s
+33XNPfK3sTSyZwcbL7OVx6ZFd7y47nYjGcfOl5WUbFK6jGO85fdlu+Oj//MUFZJl
+NZf1tARwa8BV+AQDgQB3/wP+ffir////pgsXwAAAAAAAAAAAADkAFvAB9CgCqKvh
+wIIRClJBQGt931KcB7ue29fOM4xl8OCCgCOsAD4gAMCCqAgigO4wANPNs0ABQWrw
+W94D7vhh57CBAWsPbK21bY1p2NSlc29vnvroj5VJCRUilcbPtq+nc7762bq+rYxo
+GIRFFTW+199fPB8oqqVSlUqJfA6522q9YIUQr2e0dTolBEUApKpKdxdyiq9PcxXp
+pT7XA1zw2DoUqJQtbhzOqiUFUEnrTwsJplFOzKlPLNubxmlvLabHh70vPbs9VSlU
+C2aInZnWUtKa6kV06iV7xWDfctwDvZfbVSHSMzex1T1Xu3dbtgdcgV00eRqTtivM
+xlkDWp3c5VXc0tLhitmrNiVChF12zldtJ3W27okKoCs8t8djvZ9jdAPWi0r3HoNJ
+bs1XKl3dVs7jAPbHmZ03gFeUl02d2aYcR6bmqg6173G4GXhqegQBAgTQSUPUEGEP
+UZGTAA1PCCSJVT9owqPVMeqfiQAIxGJkYAEmkSIQjRRphCT1GTygAPU9TTTEACT1
+SkiFPIj1MSaNAAAAAAAApSICIoiTMqepgUaeyoaaAaMgBiBUSIIIgRoEJkmqaek2
+po0BkZAPU+d9mfOtn2399/UaZITRTREBAJMILEUSZiSKkYAEmGm0IokQKAYlDGAS
+ykCCmWJBQBpkaKQLBIiZhJpSzJEhDTRCEkUETEKMxQRSIxiaGQREwxpZEg0KYgAa
+EkAGJGE0ilIIhQZFLKTCMSQMkBYoRIUkFIkmkQMZhGYyJkQwIUUkTQwJslEQk0IA
+pAEEkJCIRQLAGUhJM0NCzNDKbFlk0QYEaSCihZRNABJhCZRFKJFkxIKRmDJEZZSi
+mhJRNkEjGUIIIGFMpgaQMaSRjJEYTCYoGlEQpmzGZLISlRlCGEIIyYMaZKkpiCNI
+jIURTTTGkmkaGUWKRNiEM1ERkZEjIyMxIQJRjBkKTBJiUyzM0BhkLMYkJEwQBQGh
+pGWTRjKIE0SYCUjDSIhmGkyEZlMZjCAYYkpimEBMZlEghCUskyWQyUZiGYJlEmSz
+MmKRiQMLMxTTBlJoiJphJImIigzIpSYzFIo2MUASSpKIRJiaBiFAGGmgIUlEgSMm
+BGIZqYzQIwIpIljMJIKSZE0FmAxg2IjIaNLAaEhIsCyTEgyGYokNMEzTMUiNiMNg
+jRMMYSSQQhMghBgAGCEoEY0SkZlCiRhRQSiZEQgKMGQFIkkGIySy0CZQEqIshpMx
+jGSUUKGSQogUJJAMg0YhCooUJTKEgJoUopZCiYLEUsIkGESLIajJokJjEQJgDSli
+QhGIaADEBsWJJAYmkoDQjIJNCNGUEwGZIEkqYjAsbMbGjBAZkgkBKRjQGUQQTKZg
+ymhiQIhECNhhmMyEMgjBMYCJTZBEhSMpk0zGlEyZSjGFFRQpIykkjFCoJoxhpIQS
+JoRZIZMRmiLJEMwSJgibCaJghRAEyggkQySTISQBSIJJMyjWKAQSQKQYKLDSDRFg
+gaYDJhkRBqJiSBkSyBmQJhFNBESMWJkmpEwkjEQxQomI0wJiRijNKCQQNNhaYhlk
+whhLKEYJKExEESAzLCSURhIAQIJEpiQklAmZ/txdd3XdcOzl3Oc4ca53bsdc53c7
+k7runOugoiVLVlto221GpSpUtitttttEqtCirbVttrWLW0VsraQEkhMxSAMkmAyS
+CjDSRDJCCJBly6RMJSkkEJIMhCAo0wEkgYIkQzrd2YCBRMZSmJTCjKhmJIEiTDJM
+0SUsIxIEkkRTRMyEhJCSBIBsKBMmAohgwmJIkkCQaYkkCGSJkxCMCTruhzdNjaVq
+NGI1qqn/H/D+f92/9N7/nf+x/T/BM7+j/3Df5s4H91tC/+oosD+/gYNHpnVNy5J2
+alEaZU/66SB3/PXf/7//et/nu+/f9KKr9VSKdhIptIjKzARQZZiqimGUFLMlVWMj
+MSUU2oif8IKKYIhlVIpkBgFFMIYCimSU/8VUimSiVoFFMUof/mCin/KqkU/1/2/7
+ipn+uSn/P/jZ/qZLjiqHKWmltwNK6udN0mKLpTbnFbHSxf6h/6WePKShwUl1VbdK
+GyqU5ooa/vt32BeA5cSpdlPaWguWZVUxZht422i4WJpNsWzjjnNrttYxBLESWBXA
+to5UMFuThmsrEMqjbDpYOmG3M9440VM3kpxzZ0ZLjiqHSXODDEyJisUWWKaaZVEW
+drHTWsbg1ZFVRmRGCMFFhITKNXhUhsLAnAXFVTa2xYZviazvp7z20VOkudsVqq3j
+OeGtvWOVhDnvvuoOynI6VhVKbaPHLclddm+VRwsd9tpyhwG6KG0tNMuNM0w1YZC1
+SUMAuLhnLQOupddA65UOXPDKoZRXMpLJUsrlyDY2utozHDrg6uimKZS0WgtDKos4
+KnPMppbMLnNIaySc5TMHGbaxTuqd6qpHacO527Xh33/xUTIdWeKTmjbsg0PYKnmC
+1lVSd88uqKGOW10E52BMkmKtkyldBFsScY1nFJZktZQvRzSd5S0O9PG43nhMOVRs
+OXHDbwU5iQ1kkWZEeZGOqNqS6xHOJZZIhTExGkq6rcObBbGrBOaqc8OmmJTzI751
+Vi7Tx0LbY0JUgoOEmzhjjnptxIKus546uBtXLO4JkyYP+eAcAAHOD6fr9j9V+RH2
+S/L/QXTV3dz8SL/T8qH5noZQLPqGwlvR6dhx2TVtfs9W4cn6VF1Rfst5hq6EbM2q
+dokF7YlT+AevC278qkbLKawmh4pJzRaPv9leNe26uHhSuwBuLK+a3xCu7uCt8ICc
+hqAubTDuymwW6zBsaun77TDCZizuwBP7lwSttmpSykZaG/3IVw50MThjdLpDuH0k
+DTDN0e2mvqqKkAmVy9EDwysGysaREKB2NormNHUwj0vgO6IiGsJpEuyQETJyWsUL
+zZWvlFrieCawpUQgzlKTRwiZJXKyzbD3ulpxiGZ3uqqknBCteytK6wxraGufXo4j
+6Ql84X68MHo9PTm7GxF43W97OVuPemu2nSInel9rnXmRB4ZmN2FaIWPHWBY1gskI
+XduCgbTFmxaE5YSihkBIUBZk43EhJxOAqFTkTEgZg/58BOXSVo8zbqfJfApfLFzo
+w/f/d25jXyxD+I/OeU0dcx/x/aRkaa7TXU9oVlOfGYMm7+LW4ifNnrp1XifHFxMu
+5IbmiCprTZzImVSR0Qa8znKbkRuKQuyr1cokqPHOIDMit4yc4kkbdortTU60qgIp
+BnSrVsKMeuZ4NPFFXo3ratpwLFLGtrbRUbc6dxjlHMt30iALUHtqu5g6R2+W8fwX
+w/9tjnDISkwpFIFITGooZI4IpEG2wm2m2Gk22+NttNFNpstJJJJL4r7Fo9BaHfpy
+dVdT9v6/JXtG67C17waENSlYvNK2F2WomFGFDQgRHIUKMGMIWE4Qp1LPYVOJ3ajX
+ij0R2SiUikUutMpXscLDown53VRa5NdNBc3ojNNaETWjiHFD0SSCCSSSCDKT2PSI
+aiwTiy0mbTO6iKbZNVIZ/GZuWsmDvZ2jyAcoTPVEi8HyYNj0fsH+BpVN61a8JAiY
+SJvPsFnwgTI1HXbhbNF1FnpCTeho7rSi2EUjT83q/Cmc4nETmio0AIuw3CbLSbKx
+plU6HxSnZ2X76jMxwG6zEfg/GT47sv4GvUeZiImjSpzqWhp1koVUQmYgZfQYMrIw
+zgqXzPClmVSyPgXckhxZXzdVcKyu4Qi0aa7hpB4IJs6THDITGdymCiiMCFZjbbD1
+Zs2RDWNrUlQ/P8x6SH7v7Pz/8fq/1tn9U3lWuTf1JnUUMBZ0zXwlfGtzjVdDGdNw
+/Wb/TcYvZhOV0yvddt9942XK1inv3hKPY1yG22ftVJYGIHecMa1WHrVRdWNFu82a
+cxAgPKsqap3SvCX1k9lfXPem9N6bX0uaUbPfM+K4StqpjulMkJsnYV74vTdMY1Ed
+oFSIZ4/h6sOvXBROO5iA46Ydg4cPQkTnMmYnMTmTOZL0JQOVaKsWLsGxYqhdCCQM
+UGxBBBEJ7+U3578j0euaooSZ6QPtSOwWKBXnFoZlecqTfq1/RtQ4OItiMpbHqNXS
+LBpu9xQ9UiKIOt8lmoPPrrV81xoI5KWxvXhM3vY8pR7qqK4YLstYwxOVYstg0KRO
+i1fLX6rgTrxlmqlbrkE9LEGeIed9k26rGnWed6Nh06p11O87aBEwmLoD3HcEEAkE
+GRBBBBBEkFZVQUUkTHdrccRvm2/fthj1pS2KWAbKGFox0dOmXvOlr51nWKGJum43
+BBBIJBq/KsYn0ippp9W01W5ZRjbTSfDNkM7isVOp5Wk82WrJNLTsbRZZzsMYDiQS
+QQGRB573Pe988yZmZmaB0HgHcz7ZHJKFgkEgyIkiSS9eHnk2SvPDryK1aqqqmtW4
+PSycD/w8sflE+v8v83/dyIplqpb1llszKa0Kl8tWXbMGzMy8XWnF0X937o/wO4fq
+0+r7tk9qe2FJ6z3CkozLYqzEKiqUFDKGP7kqsHaWq1aDYcCQokp/eU+vt7uZp4fD
+vw29FcKUSuratW2rX7I00/UcnqCIfPyP4ftqCVUyNaqZi2P7Lo2/nvtw1Ntxu2Ov
+M1cLOMOjTdl/Jw/jqwjhrHX7ljvTS0Ng9YWklWliFUpZUiCjOKclNiKmjWdFMjuo
+dSAo96JmslmGgyCeUmmjEtITqi4DqWXTg4318osVuX2Vfa63aYJNvvZpHIUVXXbr
+pPMYqxKrXRvoXCGuFnXhSb4SVZtAm6ojtvuIBkdOcqdgEZ6lcZZFN1kPKhJJhRBr
+WEQyIWkl1hnFU3uys63k4eJJlSIMlKqoErDI6G4EEUnpZfaOrlixLp9DvOUpB4Ta
+n2/ZW/q+fvPhH07t9H4MT16XESiARMKUE/rVVU3KNwDooJ7dlAzgnD7EhScMIYxZ
+/mOidHDestpVUIAEgC0t7/m9fLzzvPVb1fK+s+Y+f0Pon6xzJ9vzOD8R9GeLf1T5
+3aq222kVRIqwftW1VyfHRO+89MPe5zaktbKQr49+/jZmajwxNu3Zk7fVWkSWG+K2
+a1xZlKFOw5BlJpDTgyzEORiGVhmzt4tctufPV1DsnIxdsV3SbUdlXBrTgwnt41HJ
+0263X9faPss1y+iNSMUfp/X6ff7/6/TW98cccp1bYjhzq/3uXPJj5bT8/7W+nhNo
+/69v1+jGyfY/aaf9UV6T6SQPl1Bq30rH6H4yV69J/bdqqKoSHon4AEpmUtPAez+t
+92Y5lOj2CJ7CYdkZxf0D3R/XfsuFMS/C43Nv5T9sfMZV4L/G9pvd03/3mq9yzlm2
+xVJVkOV0LvETLzsJRx4cqu6dXdXXuPQcCHb7ePRk7He904sDcwdra7Nt9q7VFY9l
+7jUQJW14xnuJPn7/TMw/3fPn4+Pj6o/Cx3cXKtqlrD9PRbmYZme3mP9E/y7G36I/
+LH+Z9Pht8Afun7v7tJGbXiaeU0eH+Gn5fst6/K+NqmUrWijbu3DZSH3hD6nZ+o9S
+qiIxVVjIQnk5/AzMrhcclKH4STg5bfDDGO33aTpJ0rlQeHwTE4GVRAlhOxMpdgNv
+3ajAlCIVM6Qe6uKg9yOwUV9eRvl2dAWQKng+meXZoWhDqzCyCFDwHzqlW653rPFy
+aXH00S9/SI7ZIaPaDOu/U2err6Wt0/RGxFCJ/FfXywJ+Z0NuUscckrzN2LlS+4To
+ymv403aBj+06Tl0T6Xne5mhKZXrsbvOuKiXR7e6HiOm9CknWsik7Lmvsvrn08oTa
+aD3VS6R5uebW2codGHht9KN5dWRYyrvSKCuOIvhyuzboi48y0eX0b1ZEk7XR2mzQ
+lIxgob6yp54pmGTlmwZ30l56vdry8vuvXD4hdHdkDKTAhgiUo5KUmzxNmilIqOOR
+j4IT356J9N4UeHHbOSSOyBPJ7lSGRJEjG2PX7P+mxdE4E9kZhSbrNHt+LR6oxuXC
+xtS3UxPlEzA5XpdlqQj4iqskZZ3pmdTpI2hJsTma3b8RF/EoYxU2m5oFB5TT0rss
+2w8zlr3Bw9jYwgtNtPCzmmpqJwmZzfsew9o+/u+NCiXjuaEvhdu9cDRPzPZbreMo
+pkxCrlWTi29L4pZEMIlfLbK+xSL0Zqy7IjaLss0ZGYsGcMGrgagM+zilXFMbIldU
+QarxUPisyxhSqeew68PlX96+Vn81ovsttNN7r2tOwJnj1OGZ6GmypFEL/OURjEXj
+xamLJXj4pVTillprNqvk5OqCY8vVrvLm3qoKGDgxzLgEkqry6tOg257kmNzyTdlj
+Q8tAmWAyU3697unetmwupGywUXVcTN9MqL1479u2I2tsRZbvyj68/LNRM01plhvS
+bN5NcjrrccL8Htyj+BCrHefe9PVPN5zrUH+1Pb6rXdo22uWWd/EfwZZbUr34gOaZ
+1MdLqLC9RP7u6RSO3a3RxXP8X0wBLkn9FRxLMv9CJEbYsiOpgpUSoa5GSlIQU0ym
+1JJSRLorCY+OqjQVlihaqBciZcOS7lgmERMS0iZQTN2xVFERDdrxbKJtzCzbbXC5
+bTm3j1zMs1uqI3AHShpYzQRbTYKYrZRILVpDLWCCHKKFK04Pz6l9+B8QwVBx3HZ3
+pHj9L3wPqk8LV2RT9q1kZcelVkMztswvhMxRjp826SggOKFASfzLUZH+Trbl452C
+rv71T9Wht51YV3hXG4QPJdqV3uZz13mwrzVZnjVLbVn+YVe62EzchMqtzShLkKPE
+dMnTiMTvOqRJbzVhxDI1dd1rQhiTqmcLOhwiEgTPFVyLB/BYxVVJ0qTbe0X+E2NJ
+5FQil9Im2yK4hAhROqTbaIFD7Kzyqk3ny25Hm6dGXKvdrsl+j9LTNJyMbczUREDG
+XgVzlti/gxxcK9lmrQmuXy00nPZ1ZnYMCOztzV44ehTr4++n1Tt21RvA1/+natOd
++etlwD45o3FOGbqiF43Vsp2VA9kWCP6ERX78Jds3aZdJHuSiVaYad/n73gTnNOq8
+bUvQV1ck9/tFEv8o/X7P+1ZhaugDmvV+7UkaQ/vHB7fX5WVgRokFFMNzV0S7rpL5
+fPt5HpdvXdsa8XNCJ3dO64RjAXp5PJc5siQE7p10k7q5MlxQkHbwYYb37js+uXMr
+XQD53nebkY+JEQ3Kr6j5LcbHtxRKez7rjvN74ZI/binYF32Tatmu8Be6TXLsrqtU
+SyjpPtDkefbc/yap8EMZR59eNbE1KJt1yzjkr8IrBj8d5+WZHW1FCToyAsXOUEXr
+Wtq1r5tZb+GoluBz2+U8FT3va2RkKc6WR3ZeNn4iq1okKrUThD2MqptNGqiTJ4M2
+f9u45+/nwFAQyTz4I8lDKWkdQxJJEruEVFU6mHlMh/SyVffytduOEYY+qcVewuWR
+7sCx2jKWaQSEq05Vh2otTsmLP8nxVuGAJlL6CQ0fXzP22Mn0O/dc+RzxqdnXq/N3
+KIZUKGEwHCFgyKwJcqXSyY9+KkWLMIVwWZW84+AK/Bz5wnaLI44LmU90x/EkyBYo
+YS1EJA9jWfE+/5tRUV1ipCoof2zsjgKQ8vpHUIwQU4hNNSOW4tYulfaqfz6P4wYH
+GDM4DID3+NqN1ONUA/PfuPMRXS88tk7zKq/wt5RmaVy9WAxsjPw3pHVUomq01Y27
+q1V1m7Yd2KfWl+O5Zq7729d9zZ0l0p3fEcrJ5YgfbvWje7O3f3xZrowIWRkq4O+T
+FRyxJpiWo4lFPH3WrGdl4cvrRgQWOs7e+Rm7Fg5SGPs7K8wII3++tGhUMYuglST7
+5KtdoyntNOHVVlYkvFyJtG6k2rcPNYnRazDvM0jtv9e0GxHtPw9lbsVHo999iMnW
+ySQyREBBJkSLp6BsnvG/p9faVUKlPzdQ/ZVIRVFqLwVZA3bCzzChJo/VG3vBX5SF
+rWK1RZmzbONI5WDQJSoSvFrWQPYWLVWpk4wJi851alamk1f8QZvBepyqUITCUW1M
+PO3E+bYpbGJWorqrG+spHFPy6ovW+piPxPDpvMK9cLBMXT02D897907tO7q6Tqpw
+mu19VLVj5w68m9aLxrh5pRd60Z1Y7OPlnWyT67h8VWsGO4nUUKiC8Pu5yxhCT898
+xuvPfY+fhoRK5T5qvf5+ore9q8fDLTyk2u/mia2vXGhbTXwjpwro94vOKUYpdrNK
+/ilIKJN59XedxQPPGvYqUmlTpq88kgneW7DHmiG23HMo7Zsh04+H7xMdo7xOJJtY
+eizcYZdt7XbKVK6OL4vQLe/M+3jq86SgU5889oFKfPVuxF3wlFrkIun9efjz79d+
+wYeN/C+u3m1rd0jFGq9X89KmLLXN2C5Po/veZd64ndf3MKIxsceKwWTeL7MD3i1L
+FVj6xz2pzr8QKCFNCFKpIp+xTH6JnyBsNsPitQloYgqd1l5g4jhq6cPDUvHlmwrI
+oOhRQkOJcJfIaDs0KhNWaJJhi4g5WXdYcDKbkpiy7o20IRRpRFyOFooQ42GI3+Su
+oMuUwozR5RSK47UcIoQsIwhhRiAXHRoVM/c+S9/l9R47JC+j+m/Feaff6jz8TUQc
+fBu36cbfXyrsgqiUIyVfLNwCKvgnlBRwKKm+brfbFcOClV8LfTPJElZDw+Yw7n3R
+/39I96pWacn74akmCfZk9N7Hnbmfnm+G9N9IIVf233Vjv2K+dmOqXTgm/cpSxjx5
+NoTM+aO9xtTisCE1pRXSdT2doOxqKdUb7MQGth/hkgx+xCAlvCV3TRG0Ce6IyQW7
+O5ROkRaOiwj2YN2coi/fFuizw675bLOfJnWg2VO7rRIEXexnFH3XUPPfxRcRGzXs
+xpAtbS7eu63smcY2W+6RTU1psvDNdHE51pxd+N1FlWJbYbvu4qRoHx0s6pEIRV8N
+xbCsclUVRe1t0Tr9/qt689+zMRbOMBXqvBVD8KyFEO9HimPzqLzwaL5e+3ZBPN5Y
+7c/Kfp4kQCKdTjmOa/v154+n3TBe7/D3+v6r+/voinkqWoitVotACCo664ufF4Po
+3J6cfruz8fcQTLL13Kd1yNXLle7zzhNiNjuuwY3dvT6en4e/3/ffT7fX3eKmQXX0
+/wDQj59+yNfHDLb2ngE11HTs1D00z1Rmnx+dfhwbhbzuLp0qd0QHMBspKuzzC3ON
+dfyL9+3rQfBoYPjz4zsDVN+WG7vLnXx9Tr2sSvtE8MUa1li7Bpqrgl9mbKWWkUrS
+xt51NbR1yPPlQlNbX2vpMO6OipAZVCnOzMdCcdMd8ANNA3fU9nxFkfotXt+qp9oP
+k+AQUQa8iUvJUoSVIGwuzKjMpmM+3+Z0JJ9oAjV234RfrNBxtZMos3vCkrhlcmZX
+JZqK1aqYUg1pqK4fwfD1WX0eSASEKQ/xP5j5X1rQTbnv3OI8ip3bm/IdSENUwIVV
+CBlkpUlnZ2REw9p9/blysnsiOzjy+3xKhFfg6Y9VKDt267q3dT8u8J9NhYJotAkH
+UBPU1WdVV2dPq97X2saP9b/I78+d+hJa9dsO8Dq7uuiXBGuVPDdiDl5sgMgCCkTR
+ucudbu90qcSryhxzaniH091sPgD3KHqWgJEDwpMCgIuFF5DDtnI77sGMf+eGrB8U
+CUkTW1qLEWR7RSwstGmUIlsNwAQgEqgykQQLO1knr6u1ttq21Hb6I+XSd9/RPL0/
+pE9I8J/gr8OkY248frxb8ffHG2a4zitLxY9lPyn2k/bD85+59xlp+/KfS6jzTDGV
+KlCSXUKDuGBA2GxzjS7K6hA7uoAgSlLYS2qL/6jhPn+y2y2u3o2Tt0/s8v7+lrl/
+tPT9O/Fvbfdk0V+HtoX6P4/h5fh/Zzr65P+z5dyH9HPb4K1fuqT5PuQMhcP2210T
+TD6Tx8InpqHwj333mVmPK+Lfw/Zy/VOHTmPh/Y4e230Y6cunLw2flSdvb90NP4n7
+P7x+yfRP3enyjwH7P7Pb7p+s+0w6WTLFVJtJ7fRw+3jh93hw0r/PVq20NKhwUT+m
+nppNp/lXTSUy24lK/p9p+x+7bhT5Y/39es1H9J9h/LTt/Ha6djhODEY0qtFflRyn
+0FY5fsE/Dp0+HL/Lb9lnh6YcP0Ym32Y/Rwp+H3k/Kf3z7vTy8I+K+yj22wqny+Ps
+dv3/tbwj0m1dOmO2g8Kfo4emjSqXi3tw+KtNzhy7Y8PwY/U/sn9o/l8PSD+utZcW
+37Ph7krkPur4qw0fu31nGszW2itKPy7n5Y+v8W+vzZf2Onp4K8qjB+bb8v8tOH1H
+B8o/l+O9+G0tG1pa21taN/eU7knnyMCjBUlf4T4Nvg4a8W9DpG34af0dOXz/L8Bt
+/Lo8d/GXPh9HDFcPhj+ngr92if2dHMPk+xw0x+XptPtbdPTbXxbFcOvGltuZktu3
+B29JpHD9/l+75T24fcjp/93tG58fLFy/Nc1mOE2PTw+O7a/KsP1dPKz1Ielp65m3
+Lly5mZmOW2qiqrJOg0SUOpO/Ym4AUdn91ovgujOz4FB0MBZWJO4mPoNtb+7266rf
+z9zM1txqittGlEv4/jbbCTioBO/q3CKi49u7fnvTo05uxVVX8Y0CiogUNx5JLet3
+YPFu7NOEC+62c7AwsFCz2reusG9vMFWax1VlAwU1dUyIEhit6aC7Du7M7VdNstC1
+lXlm7XRkSLM0jajTZqNBA9IW4mqEa7U3XwsODHDZVYjuyTqypLVdoZbqcyjdlRjo
+dkyjWpGBmkajVWlJ1DzMPPfJIIJJJJPAQDIGiiFDI221bW79r+Dx4685zOUWtrbb
+fyOzogfCvL38Olr2TVKbaW0vvu6QF5fnnbMxw4f2Y/dynRyqptyw2Smnj++v21rW
+uHL/Sh6afEfd+rg7tq21/aO38mnw4SfDyY9KYm/9rcSPu/X7Jy8DtpVNp/s39X6P
+xVjyn28Mf2culqrID0/Z9WNK9+LbXseXB+yp9IezTttsnsw0m2J9HPXrTWa1mZcr
+Y5Fj9fX8f16/rtx/W/7ccT29K9P8fS2fRp+r4CerERJEebBr/HVX8Y2yv6ZK4N87
+Oc3/UFSf54kQJDPt4hEQISiNsJ19vv6d5ePOXnLnKlVRMqnKJRN8HOc4eHnBzoIH
+MpAZ5mOq2Kzf1XTznObSPHfYLFdt2e53f+MGA8zED54z4hfEg7rRJfbXkeq33bpR
+ebgJAwUvLQPVZKKFSSDRYI4wwgQCBcqqHmqrcrro/+ISKcn/1pVyxUc+791ve+Gi
+7f91U5/UtURLrEFwxif/K7mLJLLBmTJklllMbAuMlEryqfWitYksSyFR0c9WGSW2
+NMjKZLbGmSTzVb7Jbba9lttvnPje29ykZaxopllRLYrTpUlc4iY8qqyI5d705MZv
+u1ZllGstGZYT7z6Z6plQwqduumGQywMcHwrK86pav3RTHhW18XfjLFYyWbjorjna
+TttpVOBUpg27Ou7MrMMyszLdHBzymitUJ4Tz0dVMpiyXRJDbskep0BN7JGO8mdHV
+Pd1TStUzfsg4eXuWE9PVt2juEFWDZr24eiXW5DE7KjZzEOuNZG7I2ocWRlLYLVvF
+GIucZOLIbpOKjLLUtRat4sjIGnHJoJtX59aGaxoZtSn3kjr/BfvvEueqYoavHjKx
+lfTkQc9PwqlPyjh+1Tjaztea0tZo/XVFD512U2EDj9tVTpSLeu7zGstZacdMaS3H
+LvcS+9fHUcNsArlVO3L8To+YZW3QdvX46+4ZlyqnDs2vzrkqcOL7lnnrnu8/OY54
+O1Vp+VBoMO5sxa7ODUmwnEJvqyTdRq22yZN7KutPTVelXigrJvTW7bYeEeJUxwNk
+NlWq21IcSHn3w6MTx68cHTacUEfeN4zPFzT3uFY7X3XTNafe0tNeKqbVU8s+c5mt
+7E7erU+HTx2Su+OmvhpwPmcIeHwW7qx29oNMLvh0fHz44pNODegO6ZMEIgYczrCT
+WdKk8MDFGSiuOOdBzS1zZzVoqio5kOTtbKzi7aNMZgoHKdbV9Dlq7N0h523x9+6i
+49cdHhy5L3Kdee8uTrlo5JI8MkRs0xx3Jy2Vtbxbho8Fzs+RYy555fVjxRvjk17q
+u+TeMhUNSCJxOGSaXOJIampROLhmaO2zc6CyY2kbd7PgiY9Mkmm76s3Tx7yp8fnf
+E1+NlrW6nhoz1fPXb3ymeTtuRGa89uIgybYSRnch0uU2n5K6nymfCrxsnUc7yc9N
+gY+UCpqeMhw3YTjNExOOB6OpwmBt07D27E2yOkgo92SedsjGFb5T4cKHWuV2M8cF
+8zMy4FsuJXHLaRIdimuHBprXH3TZTtjDi8eLZ0dKHf427eFdKGF72HenvID6MMOn
+bCLWNsgpUEoZZG/vyoPxPnHd+D3Y+H3rpjqclZUisODjFbL69xIOG+QclTpogxxw
+qNO9m2ni+V9vD2uz1tpoxtt5t1PjrlVPhy7WwKnZHuC3ruTKRLY2yUlqGlKqWkiW
+y9iHnhPZO0rN94N2brW8hut0yR51BrPKXs7JGxb5AnRiZTl2Xq1hpiXy8iczq1p0
+4OUvW9g8WPrtcenxbXL58ic8LgbnL1I0m4MeNSM4zVJrWW9uI3DW3tqHzluUwxR9
++s0Vc0hpweORY4VOtNXbALUCyXLqNFcCR7xxw8jTkStO873DPfY017vHfEhE5xAu
+lh+U9Pt+W9++O/u05zeb4c7pzjRaWurtlU91y/Pj38bnSo+8PfvF8I5SNJ62aL20
+QZtJUXrrTO3rYPXw+NeuFWmevi1C41Gt1m2DMqHmySGsXd4XEMFkBpCUlZSTWAUm
+a5gWmZLEQcLCwtjR0rZplkWrZuMqsNpWrMyvBJ5/Gff5lT3FTnKql0x9H4PU/DTX
+OxAXime7qULq7DqoaFW7tVaVWymOAghDdEltpIwwyIooHivfPjSHoqKy0NCBIRpB
+IGQK8fXhPBpMTMhc4OCJWMuxlIYammJ2sgEEXEs8oDopthFpLOUlVTJVAqKGFoiu
+fFmCKtsq1oM33uOW59vV16cDSvt7p7+u80IySXnVy5lF3Mz5ZLDu9ZrDzoUPrekc
+9Ie3XnPlekWLviZo7sWzm9WT4r4vmvd4+Mn1zI9eadvv8/FYv0fllb9OdHfmF98c
+xiihhSVRBRSemqq32pgz4bzMD6OjNYamHHHp0WsLbYyKxZ3mLD52kY91zW6fPB9d
+GObcd2fPPjX0d4du7bA4tvfmSzb6t9NouC2GU+LHHGJNXK4s3xiY6MfbxT4Z83cZ
+UuZDLGk0mY/Z/iHrRxSY3S1SG9mvzS+bvxc44Th6JqNHLLC4ZR+p+NfpU+sMTeHg
+a67ZI7LO0gsjRa278NqHpyOH+PRsdMcqF5x65vjp0KeJjqR4dknzo+Zsle+oZmSN
+f8ttztuTWnh+4V2fpXP02u7ttibExiUsNhbdfPzh1+rQ09U+enFtXS5qQkjjxMd8
+MkkY56cYwqZcb6vi222vU9cyYersXMh7cOOI2Y7Viz6BNspac/J9fjp3RQw/gqpU
+1kIPpx1mbn6DEJI5wLjKElOj3z3XAvFr+HD+fSn8rhs166dJp1CBw82PeVw26dIv
+7MUi/KQbLXXHt4nPh0fSOYs35zI1WtZGrbfqaOvlNp6VywnitCl7G/RjngwTGOXw
+v3ThnnFFDb8PHJ2lL1vMzxiXS7Hci9P169PULTtp8MorSZB25VNA4Pw6X609+3Vz
+WTVcyRy2dbt8H177mEWSRvh8M+vSerjnx/SZfuZ0beIXSUuzna/Om+czLbbbVfTz
+54naAdd+pE26qa+jh4iOkG3g+U1FmjxmGX6Gj40+jLEntyrIn7/D+T8fy1+Pjjup
+Bc3CtbNuXO2tRdulIu21ItGsL9ccDt6aEtrxfwXjqcDx58HqqhesQkkFR5Hw5s+Y
+95rjxZ49Zxzzzs55zny5Y/Trf42ninShp2tC5MykPXPDq/HSuOcy/Hrg+uXOZjhw
+qpi7evQ+G3aueLbIW2pPLBOXPB2k0qeWcvH8dPX3537NGVVjFVhhjKxliVkqkjay
+ptqZq2S1WktJVZNtVJa0VtCm2mzbZsiNNZVVSy2ti1tS2Sq3md9hy4638z5PHNMz
+Ix3IfMkD8jgU/hevg0z6O9vrhfx2u0pdXi4ooddn1WwLTt3u0dtfx13/DwegMQYQ
+wdp85zgwAfA3hJq69eh7Lu7zLGHl5V6eivCu1elHunTwnjRy61p714uThUcOOcz8
+O1cqxabWOunLt5Rw9iSJHt3F3y3WWZdtujHhx50iRPHtKachw2vnz8eK369x98Ov
+hw2vztQt4JRlnK9QFCycOHEpchMB0Ym5SeIlIUMnPFcafA3klDSwWSTX9VVFP3k/
+KQ0+nzF4rj5wtvArh604+dqCN3Qjz0VcqypVmrlXVlSVcqyiSeckRld1JlJlRlJB
+zmlk1LS0RqoTfWN3vzzprfXjY+ZUWT9c+ednqsvvSSJCkAXphQSFpCgXIwRJFQeP
+HfxpU2Op7pg4ZhX80D8P0HcE+tvtafe0PslS2h6bEUphB+Trt9zcMySlFfrXx8s6
+aKGUneDdfjQ99/yYfX7l9meCDI/bvJDJAQgdu6SzNW3eZlBQykZoKrwo37d0TaW2
+0DnfHOPJfg278PvnXg+re/l0U+vfj83QmJIyIhDN53JH5Px9XhPr2/DXcY+NzGJO
+6t1p8J77+GH2+xfbwXyN7S7ySU8e36ZcY2cmX9ZqJVTbyyJ9LNd2Hy9pFJjOJx48
+YJh9fxDDVU7nuPtjdzVxq4025elJxy5kTGLIXu3JDla90qnLmi/u/hOXSqnQu+mf
+lpHZt8sRqH7saHSSEQXU251XwY4dOFRt18lS6cUnTgWreu+m18JO/RkmYWb9Oofm
+aH1PPXk244ZeFEhws+fI7cknaR6D4fDdfBuITwr5+BweumnDtjA5GjvZpuOHS0si
+Djw9vK9vVXw3M4takTts7RicqcARg31RQ03CvXwCPOWh+DxPrrPL04oI3S1HWXPL
+V28NsefHEu5KGKEqe8NJPYLCCHQMJCQ7PR5y21rbPLh6zyKm7rpxn60/GG3l6l0b
+Mqm2VCL8CsOWG2Qe5VVUemVS2xUlz8FNVTjEzB3gTsxNJ2NL8fkcfOEhUaCuYPW1
+wuNRLHrVBHPnUBbfGqqnLbx2unVlEqcfFU674T6+c8eHON8cbcPxnVY79dPSQXrj
+j02ctOXInljHDTacJEg5ZB5GNDvHrWNOquSOU5GHgGIrXB8Q3PTh49XFuZnMke3D
+Pi349tnTc2x78ZbabfvzMff1Q00qpoqlPdKqaqUObw73hT5rm2u3Djb92qrt3QRw
+acoV3xS8qpNypaaM8CBy9599F75+N8/OM7xre29w+OXpOnjtyeGSEgrypPNCAvLz
+gjvv0nE4N8L06x27SNPjUeRJEjXk3zlzOGsVtiMq9O5Hkcp2VPh8K+XJ7XZx9Zvt
+531nPHGb550jpsrvKpnZ7X182tPp4nB2m23Dj50a+PuHwWvHvJzCvWfD1elNOsfN
+SEgw75bTbwkkc52410eGuLbzmZkZvvVmtPrz195lSMXTdO+GvWa25VN0UMpetNG+
+NwU07IY+Tmk5PCX1drtxw6VwlEnsyq9FxYhCRtIhPTOT09a7ZutZpiLA6pDtYY3V
+5igfFU4zU4brTy7ejat64Qejh0SJHTSTZ3u3h212EB3mgeekTleTDmSOOVnfrh6P
+Y8ntJJ7Pr2KTqnMOYbga2JznETGW1bGqmrY4zLwt8niQD18xElWURb94FyqjnAZ3
+z6YJ1iOcC2nMPuqLNVQhSiLLqoyCroXV+YwVxq9cddcOZJtS0iqScZGJbLQOBQXO
+HE9q+9mbo5znrM8crxzyCVKhGIK9qoKpR4L0FF29epznKxmhKoosQGVDU2h3Ay47
+SFIJE+nw88FX5l03vzu+JfbrzePF0kBSZvDVsr5KaIWZmJzqUoIpQrMhASe/z86c
+6HyL3ZqezLvn2w0+aVZ7vTMRFUZPLRe7Rk+Uox4XrFfp8/Xz18+/jybiRw7VvURT
+5MeVT3Td4+Ma5xHFTVt3xxqcror7cx5cZbWPo78+Fcp3j1jCSRIxTy4+XByxM192
+To8aO6enDlp8Tpwnp5LwvE56l2zffqYlRPPQ4gQywiSLYYacvPXtw/DHocyrt2j0
+e/enNm57m0qsB8YrRH1Lrhwgi85HTIViqnpHjX5odbWnqdJNpywNzy5F55CTpz3b
+Offvji3GWujD788zPCvnTt/r5SH4mbMvVznmrtcufVxUd3tFD8H+XCVA9+aArHR5
+t2MPNpfFspyylwe0mEjs5oJOvfjxfnnNXNbdJPJ5YcaYgXzEbNNe/DNpS95PXWbX
+Lj5me++lriwkeI4ck6bca2nHauuzfPTyrxRXIm23TPacNjajfNUa97T754q3c0rP
+IE5Nere/DaZzyBPTHL667M6YMUiwUw84c4W+5rlfVR6zxCzaeKly9x9x6DhaooPI
+1CNpPHVtq129Z3bpzpOM14nhw8c8mvgVGdYiu3n1jtni6FPTxEt8uOLVAnqxzGvU
+4XXlc09EDkrS68VHEuLovfh0kKjn16nx2624KnuSnHXYVkIprh8uKrXkxp5Z3aqc
+aeE59GkSJ0a8drt6aX+06Y9W1WYqdPi+di9Pw6evm8zGnrTzvvv+GSuG79/XDiov
+H0qepaxPYPTbhXBj1xR4w6Tg6NcOybV4+Om+3X41ItLvfGlU341TWO2R7tSuZO+O
+3asyajzIENvnh5J4Xw8OuDlfBN8GUCx4420ZVU52z250coXTppy6fELl7Rjpy+nP
+x28cG3ng7sNCRkisEe3Ltzt62dtbszTgXpLw27ePvRw+vlFcKR0ekbTaMSHDJB5e
+nZ8vLbTt78dG25fCwkJ//etW1scxPdFsVVsi0tFqS177RsuXJMklSkhrEjSwORa5
+3WlxTnZfjFJJ8qqYtJkGIYaQX+CRXd/3dKH8uAJ8Y9cu+OcSSPAL6Gs336Z468Zz
+vNxQRIyXt3dm7s0SAwKIJ5wEk8AwcCHFznBwg8o1kzNO72t3vAPY+sfngZ9dFb0o
++X4H6XmWneYezTTiKIZ4CUUD4QEQCdPGmwTwkyTaXmJ2d+i8PAPAvDjERepd2Z2U
+tFeZqfopOh7VAjAeQ8BPpenxxACAkEQhEExObQ9XlR+e37Iw1mN+ICD34z4TEzKK
+dyQ5oUQnsRgHH1l1ker09IZ4KIqyrFUOLmqZbKLYUGaGAgOcGgdbwVvRho1lbYNU
+cdPj1zU4ogY7l1TxfNNPT+zP92ta1Xu6TpY6QeISM9/hrny59kjOErh+Ht2BPj57
+6L5BzgoCDQAx6HNqd9+Dyvbt27Lq3osAuFDt/Zv5zu78vxMXPz5rDDqp1z+Pi2nh
+zxuQkFAnqvWm2HD09db9dvJvpZ775mY/Nd5n5du34vVU6F+N+jTb5SesToqJfaen
+DXwdO+bu81I8knny2dLk+lPtFD493Hx70x8+ZnD/LrkygIFr4AcZGrTDQcMwVWSB
+UIKC4cStoBZZEzt+9tptwYhbUixKXVLSo3XvhOmipnoTQ+XBJCdfHJ8r47yZmPlN
+tp88W+HnzreZnj2dX2cPfT3zCQm3ifI8tvCeDfBNnl0nnzDynndrPNObjUhIM70k
++Phvzu5niebfbE8NY1HHuJBzqbt41px6TjT2wnuOfnskTlZwenlVTqj+HnLFtEu3
+oQOnRi96VHqH1D1c+g/IZ9nQp1cZlfv1606UPjEUVw/C6dh+Pz4Dro+bIdOl2OTP
+vLTZ5+7/XSX29Bv0PSCdHY28GJ5eY3ddXvTet3d8H187Yn31vrt8fNKu1D4+cOuX
+InT13p65ql8fJv74217Pm/vXbqk3NtnkqrqnTkK7wpfdhA+r975xmcNIp7Twznji
+evTlp74w9peduGxXiNdczaymNYnPSSSSFdH57db5cA+GzcQeEkOBjPVentzlrtHQ
+fBtWJ18UIb3yjguww+BUcg8J5eHbljZU09Ja1euOjrmjp59ooZ2hzKN2Qay4mLA1
+pTOLMipVkiB0k7w4rISoDm5vGxYTTI8ymFxmtm+OGuNY5ZPbcqyxJP8qLkqcrsuN
+XvVCjgr1Q3zy6o5T0ZznGJlVeY1Td52qu2m5V2aq1GXbu10ddY3rOrpy0u3G0gaI
+oCqoGaZwMADnKp1up7vrdzvSOe91CCUrW9pWJcngyfSVtIngw8zxCUFzpAJs+tb5
+Zsn1j4Dp7628zYe6Rgm2wa9FYc1vkPNMB5NQ8Ic3l160dXv1c6zek8W9yRs1O1TS
+z1rN1EhwklOMD2NGX6ryTXTqgq+B6Y+TGD0AgzsO3XvudNp0bcBy7fASeOUcunRo
+167Ew2GNnFZG/O7eEsenI5SHrvvWZ2addPjD+TtfXdODuwvq5huPLaODCtE0ntOn
+L4e8t7dJ5M07bNC1FSRtpsdzzppPfI7dxw1640x8bjJekxsa5Y8VNtjEcBtCWwcl
+ZTbCJcD8HrfbHN5KHTo4Fp819fe92ONY4erddMSl2w76PG6tcHtZwrlPXKVGjFac
+1j+rOTbp5jOXJwuP10ofsoU9Td33dv3n1t2cqdfj9Pvyqk2efPmZ48XTl0KlODvM
+5h0nx+MfdEOnxtt86WaVU/eucz4+eu3ZVKY+v3r850xVTdadrjormihyN/evHXTl
+OFR1cY65NTCcRp8FenYLLIlUW8sJOnpScPWt7tZIJtsSOmHB33atvt8eF2+HHiQg
+NCRxrt5ejjpt8Lh0U4HvntHLtejv64WuYovx4cvjudsIfUUV5bOXl6xXKF8KXjpP
+vQ+fOmXao1fF8OImWnu/i1atr4deV54zS60z0kRUkUeKm8HijJ0r4pFq7Fh+ZW0p
+aNBfXr10NlfrR0278/Td06Kxn1/HSm+H8Kqdssebvr9V00fgPx9owrAzk/h42KL1
+67fvfB4VPiUIfGBcH0P4etPoVyKa5fXxT68OOsAuVItPWj1w165dPPO3Prp1euH7
+9fds6coXoqU5gR9Lj1cVXDfOfUFnHKJcn73553ve94fphI76boE5x5eZtBy+Ht3z
+2NsO2PGCnbwrDt+Pq4KodNhA28Ozw9e3Tlac0vVRrljGXXjK74Z2eHlKbXHRrpJ2
+M2gxJI5S8WzbWJB5fOzzK0ngIDK6THQVqb+66e221x72x9UW+rxDexdJ8d+/O9Zr
+M1mXw8jyxjie+j29RJENvabZofCnhWL1wD3ljj4BcQ54OO0GkHSQe/IN7t4HfjuD
+tPHLp3KlkOazq8sUy9Y3tjOLJlCzMmaWi4d78Kd+VQ0sVjFFisKSwqlNNSpaCyMY
+JhUqbN41WLJEmRFsshFLI70wpzxVDVJQOGVDMCz+Yz50FeeCnxee+p0OKhjnr5nP
+et8cb4wgYO5ud9c665eXro2ZltpaqQ2VAWc7xIg8F9WbmVmuss1wH46NPSq6o+75
+r6ndGvN2auHmEkDx6GEenCEQjUVKH6S7o7nqeTy/VH1TrvmVfi24LBBw8xYwSNpE
+8sJnV1c5fbaj7DwBMORMfPLNZvLOcobrd4s2vvkgcp4VXw0SckHZ8PbX4yw2pF80
+01SGzT3e1kxTTTd04UOGN4uYNHi8W+3ItR+t5UkOHvho7WGOo9fXnnm5jU28kkcn
+h8ar34DKQz8PS+0UNLpvX12vxVVT4FixZRLGVTCKg7d6NpMKY20fHFHbPHAd9cW8
+W3B6uvHn1lut71682+3b0eekCcIhIfPBfemlNvtyBHAV/OuTYkcsZ7vxb3PCthAc
+J5Tp8ErwsxlI0n3rzjvR4rr5meB17QHbhSBLIyHa1ZzsIKrDw6gTDhlwJiwFxV7C
+TiTvjH4uOQLhBYpFs7g9iZz1eObpyecFTp09Ydve/h67KmyAMb5631VNtmzEgiaH
+voEEA9jOcHBB6Y5jttTflN4ntsbyJB2kkiqnekzu324+Oz6u+mggPLyZ359BJ5B0
+H75vv+O98cccbcv12976z0kU9dPnSF745HyYQ33cpPXoOXLOhUp0DfHblUbbed8u
+lr64ejy5Ydw69Z2I9N+ed8a3ve9zh58tTm3kTpI2VpN8Mb84XPTbiYlSnHxsVKd7
+5NOQ9jvhPHro9jznCFWeydPNaNzME08nR6LWss1Ouel7em2Jvht075zNukuFDuk1
+adIWgfePGTgVKdrr4ziPTO8PPDtjuAh51atsnp486Ws04OcX3GrzMsVSx9Po989d
+4u9uULJywb+G3r10Y9F054GPrm4+L04ZJJkqxvxw8zVtr078cZmaVPNF8eWOnzjt
+m+Dzp6MOXKqbXT5aKmzzblVTg1w8Fy8+g7bfFrpVSnXPW1fHbb1XDGGpmJERNfAa
+YbUdLIY1MzGDJvWaVJua1NSM8i0YiLdVbblrW5bVtO8YJSMqFKEhgmDmWUhjLJDM
+DKMoiZY0CluHGm7ksuQolpmExItaAGFEt1JhFAmUBNrbKCiJTAyJZtArEMXRREHC
+ZTHBRGRExxlmSkstEbmFe7IABXoWWFGHTOoGks2lkVQKlwsertIkulaYxU1YkYar
+IugRakIpIA20qUYZmFcabhmNazfPjwNMIdbaUG3czeq/mv+/sp9452V9fRjeX3nA
++uetKRd6dGlzfHRVjgAwXV1frY5IFJFDJHyc4IKXOHll1l7lpW8epW5ML2nMCWfF
+zdoNoJaHyyw0D1bEtW98yTVcnh6l4fNM870OjJT1pY+N9aOlHSOoPVAjvfOy6XY2
+YjllLzgBwOAG54zy9JMd5d5Q8hgek7RpQ8GnkrxxqqbKdNcHfWnS55Ncmdbrjhq8
+o7ZUGlvWBfCumh2vHI1+9s962fXxMfAcquYF86TrDOPl1vW8b/pXKecTuBeH0U+L
+2fGp45XJw718Z9c+sP5PnLvB4ymlt2KlHLXaTto+Lz741xvN7za4jqJInjts1qe5
+S8qL8mlDH49Q5+dZrXjzpsqcd5m9LldKpvtv4EDZ8DPrN/Putb32490+paWvg7pO
+vrlKWmnnI72+pedYn31Y0duGm3a9uBOGOHp0h1SV29OedcZxres3mbt32npptw7E
+xetpdUUOnblLt5m2eaqlyh4KfAeqHL66aztyzHfh69Zol/TfR5kRkieuPNq2+3lo
+JODHljhPalUp+OsY+bVGsXp3+KNK9OtuXLOAJqZoZPU24tuyRwnGurXKohrzvvvN
+a1ts2nXKnipqQDwxOu8bJI6ZfCCZCNw6XfbiBozK29Oz5zmLqvm1x9cipT7Klty8
+pOF329uON9fPvbr1pzeMpPe+Hr3sIHq4+uc3mZ3PLvZO09OHTzESDs426htwdn3f
+VRW3ZttTnnnM+rHbw7G+GlU7XPMqrzx1qcbOsdvGePMYn1vf33e97bkXTF7M1573
+x3nTpy0frx3VKHxzqqHTh4ED3htxzp0rR7w7XpnFbjBaMsMAti2WdMGWWphmA3IG
+ILJKMBLTKBQMAVWSsjIorJMWW8bZqzbphIxqPLNyrUqhpj+j5VOekvjvVUYBwAAa
+KM8rSbnby5mMvMGZKspWru7uiVau7t3V3cu7uqaSIWAE8B4eAc8bruXXY8ta9Ryl
+s10jpy+y++675d2EUSCjzzqZO093qYXV3T5vii7tdBPVdZIj3ygmbS4u+tw9U5gd
+efWVrXZ6tawSHPWTXMsxnk4iq+i56tphw8+ToZ4O5ATgW0MkEcLw296lNsfrDk50
+J1jPLRV90fWN0hz8XrpcPBenvXi8edeZs4mllq+utW458+TOnpnKJE+E9OPI7Lq6
+OG1pjRt3w5fVc9jp+Ncu5Uh7FTth7vi3HHbwktHIvTl5d+3CHhU0LhwySh1NMXTX
+faqcvPWZmV6OkmSyxFrWcJrWi1kksrvvgqr6xW9zj1ymeq4dcNajmbSDkR2mTlry
+5AnE7fgk9Tk978Fs2pXhPvjltkl3AXoF93yfjrr84+98655556eaKe/TcvX8+tDp
++Pi1RQ8fdUu2pvFdMbdPAQGNN8ivU7S9Ryc166k8yJc5IdVFdb88+uu+/zeZveuG
+j1wuL35UllCnrTCt7IYcNxThFFbQtqjNZgXr60baY2hffWp4+ubvM/NIWzW5Uj1D
+p8eU+ZTg3naukLoZzl+a1n3vGta8samSFp7nvlKVuVxKevXTjTg2duJ3SfNK066b
+lwcPF5xw2+0cZJzrx68c3veNZrGOHXbTSSRwPSDE242fCWz4vTsVKYqOF4bx775p
+0xeOddrOpVXqcPaqqOW22WtV88c4xmZY7dL6ei956V67bbVtWu+nzM5fLQ6pS9sJ
+RXrzSp0cNSpHqF1oswXg7xoeipTO2OO3gSMFkwqyWwWmzzmd5mSrkIb9W0R4V052
+4SQ8m/L07yCFN+NEinDh32PHfHDzfDTYp2pF9vXXneZ84x6vcPRzRtDb1rS9KNoj
+G3tt8trVSm4nKzy3R6xxhOMVR5krVhMyjGXOrVEkqjaow3ghlCSpZNWBcVaxL3Fc
+Y9ZJpkrnJzlzh3m8wze+XP8uV2KlNuHovYPm99afPmu8VUqUJ47l3jmZl5eHCqbb
+HO7xlEBFcBA5Jb3t32Zl9tPvd2smGycKE9uyfDQQPDS8Ltb4qBF9a8qnudmpDwX4
++wdtdWPrzp5ZJ51IafAcnZAsPkypcqpRFBAcxIYWs3vTR50fEtvnqdcUo/dUXwei
+bTydGiJ4PFIOWjex8NM77ddunuIT3rfm5Wc23BHly1Kmmj152czh1j2qUpWYqJEq
+vL10rcCedpLOreZEjlnPpzu3bt2Pe9pIbbhG5VdskX49R4c9PrbZr3tVMdOn17de
+nw+aNedrTuVI+Pjo67O359n1jijiSSJ9jstJAwAWh6D6ObOekTEOeh3nAr2g7ynr
+8xXTOMYFcwj5xiIpx8cwczh8LfyjzhSPBt74x6zvdzHlySLo8nCSRsk0eS6TRbxm
+Z3wnmxmnHMkNhygxjtJKwkU83mOviqqNjty5d4e44KmUaw855t7i6cPI8nbp5Sqj
+jbpFk2djdy3yk88pG+mJSHbOXfhw58IK24kkSC+DzcXXnNW612O4HXcPOwd+O0Fl
+8PvuZjsCx5376uzwIG+WIPHLtDGueXTEg7dMzfR0JnnGHYm9idAqLLCyKsqxZVXx
+lbdLKpppSUky2SmfGld42pFyh9d+861rCugePr6r6xOggdtdPr4hx457uTlQ/lju
+vcrnltjnbtqu9rUk6cL7e+9cX1mt71d5mJrs2PD2zySR16d72kTx67dPB2rKOy76
+78XpyWhUp8dXq0t/AX04768zWa18ejz5cuUnls27TZy4O2rxRtxcg11S6cfNoYO+
++madlcs6drb67VY8K3zSk4YqtLvupO/Da6JNXUsg3mJLapKtWFixTMIxiMYqYxW1
+DMkpmVKMqXrbSzMt9/sqIqP+t/93+I/0n5Sn7T+QT8zf0X7f+TD+B4CttqUP4hlE
+RRRTARIfupD+YUw/Q0KfxO/YVFVv5cOFw/8J24f+hMf6Mf+DF/3MXL//P7Nv+9/D
+R8PD7NE/L5Y0/73/Q5TalV9v/fbLbfTY6Wd/hbKsn7vhvhcttfh9p/Rx9F7ThpoO
+zo/of+imn7jnrLbavsef4r/UcA+RPuf3Q+f9UqkU/8ap/+MFIjMqlZkqslsVZsrV
+JUlRZLa2yy2qaRaWWqRTKzaZooGCAwg+x/nV+FYg+fi2+gz8s/Z89W73ufUfZfMZ
+rG5jSeX2+tXiLy5tM25ZFqjVUHVXHVO7t3Rjfk7WWV5Xd3zfCC7d74/Bsvzb8BBp
+uu3U3zvXOnzxjyszB3F1Lpzy88Auvjt8OJfX88hg8tvPa23zrze8IBCEkACBACSe
+svoy46IiKqqiKiKrmbpczNUAkJJCTVerLbqur773rXpy1c6c7tea+Z7XygAnXQEQ
+RJmCo+i1VHsgGMnt6oTG4h52C6u8SvLrMP/waB4Bwc2A8sBaDwhBB/o7aeobMefe
+uPi73vZt7rVet2rb0T0fQ/9rykNCbO/hd3LcnNv0nxbJpOOM9dbX3aauDKzP4RVk
+8gGChiP3tin+2Ko0zGvv8rm997r3xV1pt67QJwiEFqEG2tbkdFH93DBwDjIPBfPi
+1V5aFeIAHWiKoxX7fYcN7XsJzs2YByCqCB9JkFUVQVTA6PRvzz5effmf8/OC9PMp
+C+ZtzACFV1K3GMDvG5p00Ri2rRwdRGfGJGZluZmRrhVWSvlPXhbVm0jUeerZfHWX
+OyPb4dvG7fq7d2YuV64ePXrvx6mb41zvjnrfDiqrwFcQ9VbJCMKmIWYsyFKsKZAp
+mGYZYsykKYZSrJYGZBVZVDChZKsAxJMKFRiFQZVKxBZKLJJhJTbbapSlmzRec3cV
+XShD4BDzmq1wkRIYPpUFVy20DjqcYA1wAOHwq+O9r3vWre0sCbAG9xdKyeSrfivb
+QO34ZArRrbCmGhJ6LPbla+t+POc5nw7qzbdSzdq7p0eJSUbVXZtq6NOrQouWy7TR
+Es2HZNRu1Stu7Ysi26gMq7VS751zzvXPF5506HQJCRi6HLltz9uN8Xm7zDLmXMwz
+p7a33LluY0zKuVZCe1T/O/Vl8LrrrqrrpOIUG2dJip/z1f+mv/K98HqwOlWunXPV
+64nVSTpZbdoyVil8PHTcq/c4iSP+Kkth+WA/sxSm2JD/tMfEf8rSNT+n1kfxMmZY
+y5UmMVMVJ8ZbwcyYSf/ThUxkMMoOz+R2qaP6HTarlv9RaiqxhI8PDkHT+8nW3ZOm
+t1jbpR/acHDtXbA6Tww1EzKi2KTySO7N2ZTCkq7jYh702RpxAodJwef/IaXmsXK/
+lMbLbeD/FpyuGQfEv6LSrGVZhmSxSSgoikttRbLU9uW0NrwxmKrwfsj9zZ07ekki
+Ej2irVcqtMxjTEjVXdf6P9p/KOcsyr/syrMkfUEhI+3yT4fG7atVVren4qxU6V/T
+taOFf5Mj/xYPqwPYq8bLlYHT7x9X86t2frOsP+5UnmbJUjANvKTCvZwkj4T2/Xbt
+J9f3uJLlxpGGJJwQ+9LUNxUfu/pLKj7vl9RwfBGH822fqJ8ukk8mkR2V7eCdNCih
+4rqR/FLZ4nb6xyNCn1IfeRyyRO0OnsT1CDQ+jZX2q4iaXcThcJadGG5K+NMY2w4X
+V16pdJLb4bb6ykpDJjVVSiyDx2/Ppatf7fHfqTzbxrUmrdbU+rGg1FD5mI/V8tSf
+V8o1D9E2nlH/Sfrsr/yHD/OP4SeoUU/V+sYwlSp/5mPQ/3D64aVkKRGlSewWP9VC
+GFgUGZCQwsROn6CqH9BPpvLYlK20kmjUqRVZgh9aaGzdo/4oxbVDFP9/xGOTxP+x
+g6H8uhV0ykMME8OXjcocLSqeqxYyhl2P6/5Hp5nNLf8IonRUqUNjY/DbO5llxWJF
+SKUSsy3EiYhPJ+cGHd98MzE64M+DAkD4YiKRisRkTDMpmR+sxk9icopWw4WnC1/0
+5aVMf79WMpaf9tje5Pm9MTeot7xUVJUoSR1ibG8TG+mE9pDBpFKsllWe3HKtI8x6
+SfEmFttpJpEsCWDSlS/NdtwJ44ls8MVRi1bmLU08xzI4bQf8lyf3o/X58cfuZXke
+jA9K/Wkv/oCpOX8AoptO3imxpWsWZVKaPlFYOn5ekY1bMWGWYopWjCWGKaLTIGkP
+wFSZp1BRTc+o1ds/D/mY0uThaKlVSilOHlj2XFcG5JxLZUjayIhAAACEhJTX703r
+bKxG0kYoRihhijZMYwxZWGEbWSBqVDlZMpZTZStskllbfWleql5taVJKGgnkxRrC
+VSqptInylG2SrIwx+wwoppFCiU2sGh/NQbbQhTFWSmMltqpy9NIxK+lX6Y+UYTIb
+ZDzMDN6G/c8HjdYsVEVWSZxbtU0dN3q1u3bFRfC4kqOpVSPLo0pZSIiQOFnZ0d4q
+sQkz4Qqa1DlekfEJApicdLA4a9OMxhyvFegkCmuM2yHU5NScI25iY4U24jHLltts
+7StNCk4frJzwu0Y6VjDDFk5RppNKqlRASOcpVq3MyVYiVt25mTCT+oTRDRPR2CKq
+KWrVqlUrlqaNSrjDopxKbp6upXldb1PU9s4hJGJA1VbLTiRJ7eok2sM+UHLbthMQ
+UFfLLbZVqqyVK+p1Equ3tpthzYl7KWLEMTEq4Ll3YoV5stLbid+m7alklmvcxMyY
+aGFGVGL1wYwx7R6xjFy7cn0pouDotHyZkzo/hptTZOkPyO1emWMxhjZLl04IdDYK
+mkh1kK4y2TMxcjHDmvtbZMWE+zDHXCnuD8yQLIjg4UlcKxjHr9gopzYxfuda1rEs
+eHCK6OCQ6xT4Pju3n5/X9kkiEj6cN+/vl+uaZ5gYN/g5JlAUHSDiUhoOAhwMFMVB
+c3DDHMN3DFulS0xrgWmW4W5cMuZhWta1rW21tbbRzrJVtBe+ulvYM/s8dPjcuY66
+qqqisgnSPat2gVwbVEysKVgXdk1QJsk8RJCBD2v8tenlrnM3edFeqa8Zu7mq1raU
+mEZP6xTGt6zMkdvq9uZwdp7PTR2nSvKidMcnTDZCbRQfLpsjVtrN222z1LI9jbbS
+Yde7dtk6DgycBMmW9OTcaTFMfB8NtuYiTvVscobNGKRo6Wb4zDniY3e2mSmsjJQJ
+4EQ2vqQkRVGM8qYh3v0q2rPteqmFz2k1KQNMUOrLk2hBsGYs7NRoFGZ5rKHrKVFW
+Up3oJ4GS+bM2pvedTh2+z59qcemFaIM+lnMKY/XLM2leOJtTiZEVfbeon1+vwZOB
+hQgviaCMyAjYhRqyLmywXa6sJtAjY0ekbBVdHErI5ucHJgQ4jsRIimS+VhHvLz2P
+o9PoKp4fLy9uDHljDyKyG7cVtjlTlwPJ2wD56Xk02ttipijbGTs6TRK6R26babRK
+3K25I5U6OTolR0fLt24J9HaeVeHM4svhpuNNlYp5eDRNLKaWrGQiqmZbs0Tlo8Bp
+tppto4ThGn0cT6OnAeX+R8K25e3KOzaUpVttKUnlUhZWFTasOmERzfpmb6O47lt3
+Whna6EmiB7nAKT0eA/sERTa2uhyCini85zJ/DpU/B/+m3fJ/wH9Y9AkiPcclOX2Y
+n/g2elK/4y2ikYKwUzMZcuJVFe362bbaGluwykCmE8ysyzLFrmryuvj1Xz/S9/AA
+AF15cn4TbNPgsRs7cOFV/dG3g0p+7T5dL60/tdkgpyzk/3v8imkP80cFiv6KUxX9
+LGz9Vfy9n0NI+HBMGjFPGRfU20/oK/wT+7+V6CiR4ktktkvJP6O5j9KtpUGP1T4k
+kf+7GZWMJ/d/NKP8Ksq/q7hRyh+q/vOT/iN1f/NGJt/f9yWf5H9z+wKWITjGZjP2
+GmInSyTkRo2qVStSThT8HxX8MximI2dIqo04dIbQvxbWO2MVGkVTxHSI0R/h0eev
+LpWSyT2p9GP8P1y2m2c1q8325VIvE485eDI9AlOHKGBw4JhDiv5HUmnSO00Q40Je
+rcSSy5GXLGVUp2n0eDpFE6T4Y/r+er5YqJai+n4MphhmLSwD8QKQoGSRJ/o+6YvW
+aSVmfLS2qpnMM9WmHTRzMJxy0qHVaVETOYZ1ScEwOJ9g0NPAmjGk0rStNtsbQ5MG
+2BivKYNI9Fvbiqv8b+qqdv6PL9GI+O0lco7fpI4cEi8XLlw2kn5YnpWFTwgTabky
+liH7Ax+fy+323r5BIEhez17ddXMxVVQFUOdlCkEiQJigNAR9MV9a+Xx16vk7dzgH
+lDoGcCQ74xnfnz3rzzvXO4dlaYNK5NOUkh4fqSweoaJidvSK2eXFtkPPEfCh9Gkm
+XRyk9PzmZVzMqjDGleXlHlJE5ZMZSrZt/Vu5MHK/2HZNP2ivmSPQ/6qw/Hu3mR+n
+CmQgJH8fUlH/NlVMZjKHCWNsfyX3+p/53h/1MZA1UFrEx/2ManCu/BiYs5NIwfyV
+9hsjSn/V9nhY5PhjI7Ullm1JVllLfJtZNrGVSVH0hBWtW0eniUKWCpQplb1tteSG
+W0qTK02llaKdJIwk+rhGI29xHeDU7WszdtKrDKsoRP1Geg1MyhiYmBApJgHZ+sFf
+yDkcXDK/ydg+VJSP5sSdLVsKtSHjkwmzZhbIuvbvTXnHN1BiMYylZk7k/LKCYDYH
+X13JBDq8YZURZWoixpkaIyJuN7+dTwztXv57+nThHDDHBkYhVKpPSK0UGMMYTbsK
+VqDzx4I8qh0+G90AAla9VKVWaW0s7IZmGGCsGJhhSnC6DSPacu07EkRI5jWcLUjw
+/d2+p5LbfLw/ft4tspaVjDMYWjCpQqLBUhDSjgT+k9T8hNA7KVTkkn2GnDBRs4gq
+HgJXCnB8vaJ5e0/l/WLbZbFLFUpVRJECIT7iSv69sHJkTAi1mJkzExpMsxUqaYaU
+miWTRpNtI5UcttEXFPVdQaiwV/wNOFTaFSaL45y+41lrMYcvR0CijhslcNI/0x5X
+Yo0kXy7cq/RMSNtOU8qn+U1IPp+mXMmZbhJ0PZ5BISOpVSySG3jR/pLeKmXKxwbv
+w08D+N6WzGTJkSeyhTax4Km0mkp+2qVI0rFU2n8SvhDnkx7T+ba3mQuaiT5PhZj/
+BPIPTKvh1If7V05H+Z/nVSKcn+SK/2dX9F/Uvj+tYktW6Y9SJs9U8H2+uGZNORKn
+w6+2/Cqtq2vpfTblsuXEmsGzllqypVLFYDCVIQ9J3NuEfwGnxGlfyMeYjQf6WRG+
+x+JPz9kl/QyP6sMY0xZf5xV/I/U5f+p6o7h0sRjp934eHA9K9T3ZcSNLGkno0CQk
+YVp8JT0vFuFfq7kInwp9TyTE+k95/GX6qj9zhqP1y390T8OTsAJxZv0pBjS09ndu
+/queeVeI9GunPNTJtIrybqni5552x0a9g4GMHRBAAhHYgg4OGOTGIx0md24x2cp1
+ws56tnBhyqW7W22GlI2+w+z4NJHpLENNvsSMmLVcLMVj9GSBNLTXNtfwxi4U4bKw
+MhtuWyY+2mWYp5ttKqpA6paj8vKRxEawvhY0NIfgfiH9z+yajt60n97P+eZ9rS0x
+W0+VV/0sP8sevxzxZkupTbH8sPl/D6tcrSqnhp05PlHCOok2cFqHB+kTvuQ+xWMY
+xjkg4SNqTWUt19K/fat9iuFW5XN8JyNMVvGVP7r82PqvjL7jtfwP8yYr+QqSfsJ/
+jvt2zClUVYzM/e1n9tRN7Zd5buwMVVKqRKoVR2YxVWrU0/hHBU0sekk5eWPDSfeZ
+dQOaqRT0r4rFtLHeZaEkiKs8vN+vcjw/CGRlxRVkq1SPDFexPt0FOvhPFuY6Tbab
+lve6MycQ4l0tzYO2m5eZhoWcZUOk7NTTLtwdLblt25Jy6YaTDpixoPYKKYtMSx4V
+/I+Nn+ZdTDBNJM+LfQOkttkfVOk7faSBw+y2ei5ZhaxgYP9nmnNi2FstI8cfri5j
+4bHPFumZbbbybHMpMg5WROgw+Q29S8lhiiGULhSjSdtjNpsyIlsyhYqxbcJrYw+o
+k8CH6HRjSvDSMVFQqqko0xiIclqrGrAw0hpi/ouV/i2foVy/oK1INsn/LKzEnZt0
+0/TfY/WWsZMkwqJFKpVKpSGE5kJD5cnT5T6BPRj2k+rIH3fSdvy2kEdD9W0T4tsh
++40PbR+xRPpJN8azaR9OJJrfGcJHGHBw2OTGMmHPduPz+ryTH3/TGTMY0bTThPa/
+xbhjyxUTFkr8JJwYmivf1xmZJq2ySlSoJPBIfK/rASBSF+cM/nZk213bMmBX5laT
+Tg0VqrbakxFiRzCeLg1rQx4xf2Vq/pUjo01d0k/Vy7frMy3JIUqSKj8lG44ZP1xk
+y5bcTEsHL9YMZLGF+0n1bjZ+MHj6OXau8pg6GVof9Cv/Y9BbWvn632UMYJoMElJr
+W1JQhbfu5MliIQxxyxlFWYJJSo/lsdkj/9Utg244/f72xHsUqlRVMGPuJWipOBhj
+qEkxqGNgop68j+4/mhRTtlWMEwwuUKKdDCxGGldP8X8NFUz85NW01rD7NpifMq2W
+o7dpQsUxivU9S0/zYuHDin8gytmwSEj4WYqVwrKqFn2kfvYWyx06X1X93T+Vj5iv
+X+C0fH6nAMNqMKFVXg8nuEYKKk2Rtat7V7zXsSJCUSSRT1tPuvGtNOFnGGB1Pnt/
+MW1VDT4EQ56UUWLFFBZqjHB69cXANNLJbE0k2zdlNHR0OU056txtowmLOO1WSsa6
+mpA1B7TlxdF+0uvItZVay3b0whrGdccXinUpEidgaTHSdubVUqqtqqabViKw14Em
+JmDeVXXLyvKySljtLGMq1t/wTEMgWhujLDJRJgxkJlQy5UMlB40srBFeLlq7bpq9
+ptq0rbSxohSrCmSRMyzLLLMSFMMqVksswFVkqTKplkqwklGCsCyqplQsWLGMZZmT
+JwN3COMLWLVtt2fFUij5Hs/SR03sfZ5nglZWZjJSqn822RTBpyxvWHlVKjTbGVtS
+KqskrbRpKaRWKlUqSk4VwY4cYMNTGkW1bk5Mk2jbg0RUmojT0wxxKQVYhbbLZbFB
+oqok2slvxSlrqul/g7aXHwxix/68Toof7qkpOaD4wC2yq1EwXZiapV6/hsyJvBiy
+EnDHppUrseSqqll+rGDc5R6WrvWH+G9by3kboLdJKq9H7sVW0OfMc6vWl01qZLMZ
+GXXa6QEItcit7KxXTeedbF5N5WV5LJkt1ZLKLEMplYlj+iTA1EdNMJwtIUTETRhJ
+/Shi7iTFIxhiMSWYFgxhilFclagZLPw+zk+h+o0bMSmKxOFfTOrm2TbWXbWV6uG2
+zX+jEamLH9lX+6Yr/YLxH1w5c28qRqX++P6v9czJ/Bpq0wP7uyQ7eB+Vf7n/N/A4
+I+n6Oyqaf8ybStl8Wgvg5aMWKcsqRmLCpH+JHY7+o/ZUcf8bQ0syoa0yWdpVOGka
+ZNpjvIUVJ+ZH6qhX3fZFanSyHdkYpGWGxtjGKcNMNKwlSpDgp8KdD2cj9bMv9zY2
+4SHDkmkf2xkDCf6LKQfCpoFaOJ9BoH5TDi2/9rCRhPqSKlR9EcmpFLro0rH4U5fo
+dOMs3lzLMZaKYNommiU6RuIh0nD/kT7lH58Cz8XLMuKhGo2V06T/Rhf9p9apP5P0
+/xq2rWqv1erT/PLMqx/K0O2Dg/csyqf8VH92myX+Z8BRTxbZHaYmgsP/J9QmCR+7
+y/0+qv0fCnyiPJSHCaH4SEiYfT7Hsxa06QsXGmMqTClIxIpRFUn8jGqv7oxG3iH0
+WUiCZpN8b6/n1+1fkq7ffeV5XQXGJARn3MyZKRCosJhcTJSYUEP9MYaSlQxKRSo4
+T/usWhVI0Ps/HwzGMyRhR1q2WLastVljMZmYxjw3K6VX+qMduROGGFymqf4nekcJ
+jClisYLIPl8mk0rZwHtB+viyyk+VPL1HuRApl/cZMDw+MZfZt7Tx7LCpLZS/LK6S
+W2SkqS0scvTSTnLcGk28PRKVpMSUr4PizlmNNE8YGrZq/51JSfi7Ts2T+5Tuf5cL
+UaX6LUnQaR5PlE+ZyTiUqVaOZTHx9XDIqqOjpwldJmO7TbfS5VtUwninQ/6Jhf1N
+p/3sSnS7Y/q9Btj4/60tF5xmT9MwRXPy8PM4fiKUOh/FVVREYiiQhAhEa3qu3nv2
+d7+q9S8O8rb0Bs06WlE0arExG4ZViJk4YG2Gl1NmRsyoMpaZV7PclFEkhkSN7T1+
+jx5uV62pGsk5ajBRIogIzWpucxals3vLLZmGWmKYUqcpZRpGE2OC4rasjHDE4E3a
+VkxkzLZJSckySoFD8JNDSmOGxNtM2uJgwFUYSjFFUqlFGExq2zQorAowoxy2rlV/
+wdJPWk8RjHBV2lsFjhYX+gysyZkxh0f3RhVg/4UcJ6TuScH1VPy29yH5DloLCqpU
+qInySSwxRKrl+50K0qqo24TykjydiqiUngn5KlPjr2zMmZmZlXDMt/QmnwPDD7q8
+JHcLH4WjVHYxiwsKx8JjVH90Yz02rRwptHkY4fT6Ksmn8HZHweLk7kPRGKpyh/eq
+bPRt8Jw9H0f9riJN29Ik05PjeYzM7a+qenD4QbH4OfJwfZMB9ytJtyhXEiMJiVNH
+cUPwV4H6o7H3fBXSflFn+Sn3kdp9U/HhSqjtSP/YlJJT9D1KWFG1D7Gn2HR9iD60
+4ZhiiTUjaPujNmxMUhRQMUxVYpiKFSJkVJXJrRuOpD+nmZJ/LmR07HlWk3VZMyK/
+m/D6vP7Ztqy2BISPUCQkdu9bzXnqeuj9E79X9hjUSttuMzBuJcLcpmDmXFzLmW0a
+Nra22stGjRo3xd71/j7CrbuqNuCV+Pn7RiTiM9JJIEgAeHxJdEfM80MFtPnBMxsr
+AgcxJUHBQgNneHDhd46b0pvHTJccMlKYUIk+5RcOXp7Ryfl0Nnc0n5iTGzpiTkxo
+FCf/H09mHBodkFJS2Z2cs427TqZEjg2XKgms0uWP9EwnyRTKCH4BWvY2oHETm/gw
+zIiIJE4SQGl2Ck88xdoqynSIaAsnIZAHItqcqEkc5usa5371h9/ghm6wvaD++Ev8
+O9O1aUzFPwkL4FbXvIfOvp571rp7GmKUGlYdK/70n+m237Stjy2V0w2w6YfZFPh9
+Hg06PAx0ppwTTGGySp/LydK8/p8z7d2Zmabu+zmXHZJtVDh9axBEEQczHKc39VaV
+T4x8bLS/TE/iYRwjwdM0rY+rUH8HTgw/pHI4Jporpt5nzbKmLJH82WyJNK5mnJ4D
+eABtlKSyi0srSV+jHaGkaf0oL5Xqr49f2cO3KPHdVlOlxT2Lbotv5H7Pq5pfnuZz
+/dmMfvq7Hqnxosaf5U5j9bbH6/WKPbcO7bK+EPh5IfmR4cj2lOqW0RIh+qOFlpQ4
+QPJP14ba1ay0a5WMszhMV5f9J609T6PlI9nB/Z+ltJpZfELlyFYfUpiTUrTJy1Ra
+mlkyy1arGFKjH1SmRptiNFKlHlOxTypVNuJAVJ4ErlpVbYWdnGukOx25SUDvhmkJ
+SKvuGWZYZZExglQqFSfb9gSRHe26lLJVfZjBJ/oiPHr3rq/pJEQkegQkCw6m6pxf
+vmXePsQvn9xLQI6KSRQIAG3bEGfh7NUKcK53UPq8OHUkcacJyvTMdOk6aVZtbeXD
+JrDQwQRBjBWHXQ31cy5mBlRZ6IYlcEmEU04Y4cGEw43ZacPubU5VthDlicPuw5tq
+27YxgrGOOrbLbUDHk2YqK5Y+iuHLp5DT4+JNH2/Z8HtbEa9pifS5hRZbRbRJLmJk
+tJK4MBO+IfGu7xq/hYNWnTpGnT2zPJAB7pIdsgDnjwae+mHsZcy3KXSR8U8MMHx3
+67L6cwtaVLbW0oONWeD2UwAhlkYAd9PyGVl2b951gXi5PVcb8QkPLMTq0gBWTz4K
+b75X2bmGXKOkz4+PNebXzvhX0lvnW92FLBBb7Y5NtIVito4Viq+U3q3G5KxpPY05
+fL8uNtqqVHwkaYHg7TTw5Y28GPVWo6bO3c2dGOmk5G3CG38p48S6HjlsNF2N5UG3
+rhMMNpgtTb7iCOst5UUraeXaRgqdGFNmIlmjFNDbT2JT0+HDbb6fWUsvKq43XF85
+mSaaDRzytq8wj6ofRCj5SpbawpLGJ941qyZFjLKFSaYxiaJLLaQhJJAkhvLrtqoC
+ttttq21FiQaI9vwrDxA5e0qy21HycDgaRwSPs8Q8LbbbaEEqJAA+29r5V87e9va2
+19Eb4CSiIivrXz3xYwYxlsMdqma+mXMuMrKWCsMVUFYvUsRaVppRgxw1JXOMb3mL
+yozTBtdtNjDDApBMAoSHCRowphkwjDBucNtDaRKMMYKomhyNY0ck0nxv7WzTGIgK
+aWfqbVi/VMlGxYTH9BkkfLWrfruDbbbdSUqaY2JUcG9pYR+O0/p+5jB/JZUMKxWI
+qpUVIKVEVQxZMcum5tZISSZskAD4W+H59LNJklKlfGlrqabJQptdXKqVKsqlUqOA
+aRSiVP6PeBAlSQJCTLBC22236NPq6ejHcSd2rZE7YfVPKyfUT4b7fr8WyefXfb6N
+MyWzwG2mEp4bur6pan33d8BXGubpOl5ed4jcsltUaNEoRiM8GkA0MS2li5l+V2vw
+4XIm74fHps8HR/jS/q+HQ8pSv0K84J8+flIn1SJ6+UsU+C0c9Aop1HStKsYGMDKx
+VVbVX8PI4Q6YTdhxS2Nirbpbf9Rt6er8OQx00quK/pxvKLQgCMAPno3LmmAsuG5c
+3ARCCJ9nkfLTE07UWQ+xE4dfZtP3VPs7YjtMjphyP+UhGz0R9z8FYVLWVdq/Htqr
+8qLbe2t9wr6vumCB9f/1f4sdo/2GBgKKf9A+qrofyy5yaOmGMYh/zf7gpXixGz8L
++5/xfK/0YL8tv7GR+gqTsvxJ9Ht9VkkLIxYsKqMPDNH2Sv8q0SrVcBPlIf3fwNJ/
+tUtJJygp7lJ+qPdeOJP8PnGm0/cbR/Cu1iq/DodIqyKlElfh9ROO50qsVPQ/KWck
+mmleZE/KwjD935YnpOIH6pJJkrJ2Ojg/KkmBVi22RUNKkxWowxU7iMnlaqlgNpJ8
+pj7iYnkVUWTvh03PCvJ5UwWAO+/U+8rwtQ/m/pYcu7dSLkkqlUIKb4AdxPxWQX6d
+K8cR/srlNn5QkJHSlU6YlWNKsqyjRa1ZMrLLMYBj6NRJ0TlhNqV6ntwbHC0tcGIM
+SikWx6q/J86IAjICaXDPuClJRcO8kmItQriaGCUlFzXDGSLiFQTqmfrNOzl03Ole
+IMWrYKKbCrtOGYDoM00bf+1W6hV/xyoRH9H1kIxEKqEqwhOh0fbf3XzNt1ZIaQ/Z
+Tcp8CVPCpx/rV4xb9LJRO2FfAhRPU75RFAhEnDwrLCvgVkHFpWj6sNJo0rweXtOp
+yT+x5Tl0wTwqLD3pVXSJ+5+RtPl5TqEhVD+w7piTk2lwGKf1bfq5W39Vr75V8q/9
+/wWTBGo2g0WqS2itFWqKtY1WosWrRVYrUaxWiqxasa220FtqxFVbQaNUaotGxFsb
+axtbSaLbG2tYrRrVGoitRVEa2iitFFbRqi2xWxVtitrFaqNrRbGrVFWsVtrFqoBZ
+kqzAMyJmCrMpSsxarGraooi2o1WxaqxYkirFkFgSQP+X9/8v5ZP6G0/tc4bk13k3
+JrvDkTm8Quc3Qw/xo2mMqVokQel047gDu6KK9vXSItvS8kwSVIXbC5SCkWVJiFZg
+hUtoVKxalLbdMKjlWErKlStSeOmTUeNgu7o2dzriub3bxvGBNRCbu64Y4kT37cPB
+IVhFJFkUhs5l65OBc/xyiJn9pvMTp04GA55Yats2p3krH/20yE1IIqJ4GE72HU7u
+YYM8Ubq87w0emUBOg4KzHejc5vnlBVjwWj2JDp78uxUmIZjGSSXv2+C+Vk2buCu5
+waLzxxtCqTeYuYkzGRiwWkxWMbuiWxbDiVZW3Hey4sc9aW7DLDfXXvBO8UcMOrE6
+ZHKIJJkSMuZM51ZhDeUpVpMillJZpvURzSaUu8TxmWyQ4sN1HLGJuVCyo1rGYzbr
+G6nipyrXO7Z7vS43pcWFeb5bU4saY8yVux4640jFLmIWjVTaVtUu6xHFmprC7jGK
+0oY3kblGmTI1k3ubEQo4klMaSc87iGrnc67p0dLLSaMM8WbgykoqxHuhUIiSVgcN
+s4ReusZ2W9pwcOl7l6OFfAh11ZNRZnWh576MW2q1bFKxVnLe+3xhp5sO/llybe2u
+6vZwQiJ63JuaKKNCGBLFFoua715rvMY1dJZyLBbrOZ5XV5qeIKQWC7JDCltJRnjc
+MWVKILJ3QpiLVSjwUMweGw6NEzJrF1i1Fr4tLGZjFiWmbSyagjBTJHzlDjD4ecQ6
+82snBkEBIfIt4B0kgWTyUekmpzCiQ5yh1wM4G8SeOG+NNwKdjDrIdZ3nnxc5azJS
+gWIWMigBFTrbdrcC3d1FulyStyYtcJGJReZlFmTVNTS4yPGPG6m4mU4UpUnHfhrr
+wWZWNdRvxxpo63XA16Gk8d9EE0Xhw0MmKiDFJNWV25mGqnfPHiSZDmy0tLVotC9m
+E3s7B8efHiO2NasFiqCyLUrMVTLjOkidBUijvl11NMuFdid4Pnq556pj0CZeWiKi
+RE4EFhe7nIB0MWSoVFVEKlEgdTKChKRIxmMBSnnMiG9dA90RI90p4oXnQyoVOzwO
+XmFFm7kU1EJfOeLl7pwCnXR2AkONIgVXEixG8HO3zk2uUXZ4KDRPGOMQcFigu6MB
+AynwUr5tMSp4Zm3S97lkYwrKbmYdS7N0thbaW8cMcuPGm2iNlkxeVSsrDdwwNvjm
+OMsQWV0bYCzEe/EuduWNOYe4t4neTnLWQ7yaysyt7Nq5jW3w84tro7rFbxrm3ROc
+yItTKia31oMVVVzMmKibuKkZYOb3Z3UnBYN1JxUtiasqwcnVw0qRd45sTvWJOrIZ
+cp3W8pbyud6rMm8TWW/KOlHvrjW2vNJMEmW6wk8+aSBDqHZe3wLGK4+WYxQYao+a
+FMLu3Zia4DJiYsHLW8vWVSaquNQVVUQ7dSGGWs7cgmMXdseVDzwzwgEvmRsCB5fB
+QVQXq0Zj5wJrB6UFaTgUTjAXmHe6AjIdsFIpFIYZ5zPJpMFN97axjrOebjescSIe
+OlxIjJYuYzMCWWMVihKxiTtW+9a1edTMrhldTnO8F0E1nhOr4yVONeDjTro3vk4e
+VFXbfM/6MUFZJlNZZ+RMiADvEl+AAvwQB3/wP//fyr////pgQg94DwHe94+e89AU
+H2NBDuwvr6eX3b72JJyiefd58+Vd8GQIqkiC6wJSbBm5uQAAAKq7u5JKoSaaqQKQ
+l21VBRUlVJEKkqkqklKlVSiCooVFg+BcYAA+7T5I+gBL4hzdzp5AMgOtGq4ADa13
+bYpbuB97AXvu0OR1329gffKPus6EiQIGhBMJE8hNE02U9Q0NDQGhp+qYgkgCIklT
+0IaaZADQAAAAAAaeiIiUn6JqJgaI2hNGAA0Bk9QAmgk9VJJEyZJ6npNlNNBoZoTC
+NDaTRkD1BiBEiAiKRKekw0mIBpo0aMTQZMjI00YIkiARpomQhkE1EfqnqNA02oAA
+Bo53OJuRwkNrkuMUJOhNQiCKMocWFChEEQrUGVTGgg0sMW2bqgkJBgahUxttdb03
+1poJEQAhSSeqS4RwucrgpgGDRopQUVIkNExkDQSGATIZGCmTCKIkUjZJZESZSaMx
+BmaRQQFlNGJKRIQihnBz6Pqb1dXa7ucrjgmcuCGgbYNpgK8AKEFIr8o4gKQFwMGj
+vveHmstx7CuEmmgYnRQhB3iu/mzlcrWdLQASIoDpmY0D1WpCxNppg6VoTStS8btY
+ssBpPUaC7k8vu+aXzwycRqJj4XNyCaEL8W6PxaWpQ2NtCG2kMTE6TpoDCHUaLpoa
+W1Dm0upHlZaDritXaTgmhQQNtsojjagMpMIthjtQ0xZUttPCv+T0I+nD/mkZQ8ZD
+zjB4ZdHI+/AJQaEvDFvWEt9eecKhyJv73XRVYff5934ryHcPuxRvk/OTX8AQBAXI
+YIooDEBEg2yTSZqtrWliJNFtWstQg22mzaljNU2WpmzNipNtVbdVtq9Gq1bKqplA
+FijAQQWAEEEFi/vVAFgAq0IILEWRBPH+qAgv4VAEvYexHwNTvPzKQKnq9pQt7ith
+SFQE3KoT92BcQS5rF1INoi0BQOEBIieUUBAgVIw0feYQlJIxilA5IyloT2iIDEdI
+qoG946hlU0gdFhujgx6GOFTZJSSpDwQuVTcllZOqH4ZyZC0BlmkC4cCwsYRI2uGk
+ouXauJiysgW2UY5iFJOlmzOCGH4iZGZYXJxDLdJ5I+okgLjdFcGyxGcTuXzC2QNL
+MmgZDlHJwpxaWwzw0jjTdXZYSK7Qr5tMVE1KLGpqexpkXBFICAcNsKQUZzMFIgVm
+knN2YKiGSuBbRzatIQgm+KaQZAS8uDHTnWrudlkM5iRrvStxKFwKKVWkrxS0Gc5b
+46jB4beDQDNZhiAYwuRpE1mlIxJctXj6hyy5cxgiVA40kzeEpxsaUJjkvd5gjFhh
+XMuSAhJw0YIxgxczl8mAJ0klHCWrkkchWY7a9j4Nu7SQ0sThJQxDvI40wEU4mYE8
+5vWPNKDdBTZq8WAka53apCRSSNpCqgUBIEqkKIRCCLDdFlqlxAohLqDOd5oy51ju
+LwUEYBLpqiqzTi6CEFgheJY6jhnYUa1qiwwzdN4qAkZJTTMxtG2YbaURoLQYUs8E
+LNMt81O4S4MhIrqC8Y2RJqiBikskgX1Ls0fwJ4OCaGBlINkgmKE6hXECwCkyUOuw
+dQqIBJJNGXYw2m6AgaYHhuJJJCxy4jkmrBKJZbYWNXa3ElQyVBKsZAmKeWFLmqL/
+aqWV6VDzrw/jTfYq6/bw8pT5+4NHZ5DpJIDo3mpeN6SJGMka7izeeoko43C2Epfp
+g4TpoXY3puxOTFNpHLlJkTMJ/cig8exbJ4wXM1wqI/cnSPX4zRN3hNeGDNBlDPCc
+RjKdSlEXMcLYVo5zrESzdhn5oQgF7Vy7d/xXre3+0a929Re2659oOIpGmnWprpit
+uWOpOh/bvzdU3UXeNVH5d/XiT9umGfzpTP5/9FU8nQ2l+WGPykDtzW8+x9V9eEZL
+xXZrntkuw70ekWyrvMhHrucZm9KfynpN9pZTE+0MTHTPffeZ6Ne/Z488WceGj41e
+xPJ4/IOaZmtZu7us13BA3KgkZGgZhXkEnmKKSCdMrtunVFC2hCzVzNmb4pa9MrfR
+5L368R+A5cTbzcuFIBItqqa9ZJWrv440HQdtONRRNMqQLRvCoXjJsHsNjp3oqjTU
+nuUk+tSSqY06SBeONJjOPZlitBWP2Y/a4myrWhja8Y48ITl3w70cPAUvOLu3N73x
+oNCWxRXKJMZBOcsIiYNsbb6IqgA1MYWCyzFLX46tyDIsrZmBdV11KBpmbcG2jSmW
+klZqbJwQmXHcfS+kqBbvzhoFYwQVevOaUWDtMkiQ4OL3wfiGhdLDJF2oWKWCGRKi
+hQlR9vBWB8QPr7h+/XlnwgBkZ6IHoruquvYHPb3d2c9Vu1qFs4DoTfPOZy5eaTfG
+EbeW2TVkZWcjbLyy5fXm3YKb4ufb/wb81JfR8qaTCaWBkN5OAgOisFhTR2+eXXkc
+3pGtx5da9R7O60uzr4vD1ctQeFni4kxCBF61C2yR4amYWm6emxGhMsrBSNygglLJ
+ju41nhlzS1oTvHIJ3iKAtp6aslyLp2Xz4u2mDjOOFZxL3c45xPx8u1djCMsttzHL
+vlwW7OA48Dxvhzz0vTvl3lSnfgXC1bTvQOQPN9u0GMqUZDiUu+0SqNTncw4JrOJd
+C5ae2h229JhHJcsamPYtGY2nqSYKK7ZkCWcOaeo6wnA5uE6UmOicOKSlx01thtO2
+U5RWOvTw6+Fysmd8Kd83F6zpjTvnstmbnM78jhR6FmzlfenLa9NuMaGgsxrWUpGv
+xczOq5bXKtNQPDHEHk5QkHLA7Ei3HDC6vuGTk25mxRUpKKkrlGpasCNz44/k+3tD
+wDe5wjgdDHrPy8gsg2W5zWGfiMkjEJmgQcnm7BcPMOgmPy6pIvZOyXeDh5m5rpxh
+u2O72A7GexroWfc4Pg/Hs7+FoQ8r9jIQtaxoXODg+TR8z0PRzeAOoeeRuMi7hdOS
+81h4GqNyguIRmNhQKnFMJWaZLQzV+urXgFRWKiY8ZIxJo6GynpoUkgAnNj57hPkk
+CiIEgKoYhUZF/EFX75QYsoLiXAfylQHsFzFbiMlVTCoUCVRu0SOlVOuaqN2WvP1c
+77nObXJxriiMINSQogBTFkqqmEoC2VXvQXneIkUdJiMdJihT4fO2rWLdy1y9kXJW
+wjNZBRy2pfGS/8Lwdy9Cmq8fh9iYjz/X4mvTlzXpX65f5J38LH6DNGfi2efIIvIZ
+10n5NE1kN59vlWXnOfKiq7ER8fWpiWWAkhS+t+LrfbL2atTnX7FlB6UvlXavrdWX
+HX4WKTvtWbyZlXdbue7pYypbJ5UnERU0llbaJ5ZvPfC98s8bTLO12ZXNItLa866P
+2611pp3tR1vrwgjnvvzhWTmUw9oSQv1dZnBnZnRGfK8QzR5ObplZCCc5ujfT9R6v
+JL1s8iD5lDfnIokmLJsX6RI1PafLCcKs/Tg4AkOMBDBIQit/raxnAKMUBAZBr9yq
+s1/QXIbVpWgIAgmEILgYvh0yWOUmv3jAUfKBfkdBqK0fOeYVyHCSZHQ6VMFk2HIr
+sD0RNdD7WUaPgRyIZcjoUkiB+YRfCWIeIcpVQPm6Q1BfgQaJofhQUEMgZOGDeJA9
+IPcCCRV4AUgAYPdw6IdQASI4FnXKQHmcg2w6ALxIMpE3ZaAxxeCoTJ0HTJEbxQOz
+vOl4O5xZ05zeiMkPQD3Jg7lQsvJS7KCkLTfpQmQlEPQs76EiGVGr9s8U7Q7yKUh6
+XQJAgcEPOW6rmfKxk0kYB6NnWeroUq8BmBHowHKGqH4gESifAlozD0+eQ0j4kT02
+LZ4WaPDW2w+IYtHZeImTcCWCRQLWBxyHfijRhjIpsF6jmAN08BB4SheIvMCQv3O9
+IBxhPz0SkvgHt3FCKbZGAMBDgJArIhI9BSIY8gc5jHmj+E+p9S/UAPryP36WOYnx
+34Ii7m5qkMm9mPRFNHfnTkYoj0GQr4OOeHrNeCzAYlhhc5B9Dx8dhsYr6Q8qgkWn
+ZzILYoTDz4BIKReoEWCYEF+GtaVpIuJ9O+zUiaxtJE68pepgbqZg0bMuPgcmlPnY
+g6RPUYjuCge0Uj8+CFpsWlfLghvvAgHOAUAaHOuBCwTEJ1iNdj0An37bTZlzLF7r
+i8nzHeJWS8Y6zJjrLCcqH4JHhRMidIZSkw8EIub4C6LDowDzJO0NYq0kILgV0Xug
+kCCZveXnig8iigRgdCLAPCpCoaA8AMX+M94icjIEiHwoKCEQhEX3HtmPnzHMo4T8
+NPcs2WZJYUlDwPX7E5AKIDuKSJ5wxZlKKsPwLwU8KDrAPQyZ+Jla9ISK/IHBC8hL
+AJi8KMiPQXfpqpK+sINQSQJGgioXVwYxvvIhV0sJEIsZpIely4rWA1B7CQPyZJLQ
+OahcYOxhvMPiDui49WezMfDbrdT686aJ+EQ2kJErap94yg2ISh+eqqB0QQPpBERM
+BBR+wkAAH2CA+KJEV+wAFcxBkBfIpkCZ2gULsgCIciHoB1hJQ9gIEguUgoVulKgg
+ntUcGAJr0oJHR6UMgdYB4JHEEfADtXgvEGyLL8+ama2oQMkPuYKfH8tziwAEEz7M
+qXYXsAoQHsjwQYik4/RunvQcfeEFs6nFYUjPo+WPguYCD9BY7j7j/PYGCWLpEvWu
+7/IZokD080Zk5wSD1AVqPRbsHEFBSr0sXtjlDoV5UI6IgNFeEvHffv4n0LiGvfQ5
+KFaH4Gqpz0Mxh9UDG/SNxy6H6DRQBcV+sBle8GiGx3QAXgqTMlrqSTAkr2SSQEFV
+9QEYOxHymNgdkGXw8Y+fRsHrgXw0GR09kMpCq5MlDiZDzgGOLxJuHDgRqQOet5Kp
+ezggkS1jSF0MO0JZ2yqQKSLF7UIgkEZK5OM/HYXOHJeOW9vBr8HHbkuWPxox6fms
+GumVzMqBnqecSQsuBDogwNRVQM9eBnKY0b2gZRHesEG2rOE4hkmdWB6V5y1KgqA1
+BGhikPMUQmrL7akye+mkvllmGuOkpMekkiTCSRACmrhLIlulAF9N5rthlpQ/XQkp
+01zssYOxeeIYRSTWbG2KBe2SOKBXQ5DU55aOtIvBbCk+zYig+CBkc6wH3bQOiaPv
+iscLEZjILNSSmX9OdgQXgna+HtgT0K4DwhmvgWOYSV0NSQuh8OHmg/ExtAoX4Pob
+q+dVHoXJ7hVNiGlVA2bGEGEH1bRIRBDhCQDs2oQtWIbppQHsVDJEQ2qoEALIiIJh
+iA5Ibr489zs18KLdIk2wVcpFRBx6+tiaCCj5EMxEzMCxQyTxJ8gAo5ZcS4gmZqKG
+0IlJiAbs+AEAgERPIieEQN50HzB2KnFiLFTJR7Q0qNQ4QXyCtKqBvJY82LSiEDtD
+SMDyDTVAlMx1KR0pMIRUiJ7YF7xSGDGU8MEIMgEjhWgojVGuXwHA5gtwUckHgZqo
+ezI2FDLsfUAQ3ZjoWaTPcjarhqjpVVrhZIQ6SsgnCohVS0itMJYhS0GK7o0K+ky5
+Y7gH3tCGO3xVQLLkMHlUMsfgQTLECRQxOLscliplNO4omhGOIJICZNgKF+kPDnyh
+3ErwNoatDOLWiFE0bhwyOBJEYDfGHjaG8xFtMBoWYA6HNgFycuim5Q7p2qoGrMrZ
+iV9I6DYoCVwCNjaBmh9VIACEQL8wi1kyAWKD09rwynBSL7BDbiUwABZHykpFUzkw
+tIaZSwCn04GkNoQOlasfSOXAYa64AHCJyMVG81eg8guTY5JtM+Empxh2Tu34PTsv
+KYzszJQ7oZY4pJ7Ci6JrOjEozq8F0gbgliwihrt8mJA2tda3aqkAfanxBmq2ZHU5
+0MvBycGZje43sNn5CYiGYNwJBIRNj/EqmR34YYffKj41OKr74Ihj1OnAC82B5rJS
+xuPCk5SnOICrQbAWFCMDZEMllsNkyUZkhMzrWJAiQm+4YC0K62MK0mlrmIc8DWIE
+FjI4sXzhL8vpkYEZwSigrGArDcBGj0gGFAr4FqGFQ1SOjTvH0TulJ1XWHAIDBQFU
+2BL7SBXa+99dSAvxCgIPnOIVhPMmTqqgYRFDUUEsUuxDfjmwMpaAek0+O9i+KyRp
+AG8DGE3qEdlsT9H5BPmUugch5YLMiAwTAkdnj7Y3zvRe4V3q41uohGNQNXT1Czcw
+ZOHoCYis+EOsTzziYOV5ZAwqoHrl2ATKFHnpRssDzmLdSlJDg7CCwocglqhuE+Eo
+jpsHOFogASPtXBwKZ802h3flM1s1tZA8sM4cPDnAT6uS6umbSt9nww6rDoI6wdYP
+ABwCkD4MpyWUDjtRIBzdU79HbBiX3vcZZGYTeQOlZsLH/hj78oFxFCAR3XQLAaGA
+dDiPltBD5eyxp0sa6DUCQ9yB3omnTqYzNOQ7dGkZocqlwqH9pIRCGyUGWBqQyCxy
+ehq7n/X63fbu3lvZivHbt2xc3MNMke2l6Uc4OiBRsMViTMcmSUZzTiouB0cMzMDc
+MhAn5DyXqlkdoH6TOX/ia/RnX2fHg6KQTF18xSwHCgLERnIs7MqnDBCuu5uA3wgA
+RixX8J05hR8PDApxlQIJmGtpRVjPTQ4WhDIBRyoZ5o1kdEjBho15A6uhLHeFCwXL
++9soCWWtfZsFJSQSLh/i4cADpq1VAz4GFTiJjhUbKosgl7B751ekmAW8qEBkjrpJ
+Tsj2D0AkIBD0X4qoEMX0AA0zQzao5o5TTzd5LNDKrnPfRfO1p44OgI4xIzjnvqR2
+Kz5Gwg+DJUL4dAjsyge+pYSePvEmKovgUXXilLjBfO4fT3oTYGwHVC0J2gKaO2qo
+GfZ3ymu7AqTWofKKHc998pr01xD2hKFgCFCO1eIWDjYeGgvGgWPaFTjzJlNzf2GX
+XyGuBywpbCI9aM6UO+tOtaQSqpWu2BesY5kXgwTFHTUPCg+y8oeXVwQ7yjsYrMak
+XS4XXDAJlUBAhUGk7oKAYdKTLFPcGom1CBxTjSRRsoYbfcOs9iE2BKVx8w4aN9z7
+7xds1BTpEnKyEY4TEIk3XeTS9hcaRANIX4k22qCDj84dwRJjo5YkxitJJAO9xXTk
+OFA/MS7JYZDxNviHhoYrl0bDxFvhTQwSQimhAnQFiYoaaHrMgkYrCOGBtDa5Bmne
+OFKwdG8DmOpCyvhqGYNRcB69KAlJSFA5hCUHKDE4GFcRwyRmEbfPPpveJJIDaQgw
+rWJ/P78yCMO9svE7GZpvnPSWaCtoEgL2jLabbxBVKIsbSY3YtJJ+NjNh8b8AilDw
+UPusGoZAu82EYImSRSk5GnwVIKWpSvFeBQnOAdAMuTV9DgEQgQgvrro7JHSHZZfM
+JCKmTtQFOCceAYcT265PCAg2SE+XhMkKlPgHB9+HTOoLI8s4BJuk9F7wqDCjRw6y
+D8yVeukRZ7qrFZYrAMMmhmgFDKEdZztkqFY4HuEkfuhz9pTsXzFtqqB5Tv5gsZ8h
+mh8x8wAfZSHNyDX0vZDTySL94fOjqfD0KHsVflvrWX5ow8Q0QhFVMbcpmX80Ezgf
+HYjMuA8wLy42E7Sz3rziuCIB2DsghxkkRy0Bzp6FVAA8MKcFvSjqknlxdHAT0wDn
+07kBQcd9oLK7tKmnZYnZZrh6DrhvciJ0ss6vdzXdwMQKJMWT7tXSHPByoD9hWNqM
+OwE85ypXmQLQwbXSkJWY6qxCwo6HFcFLCAk6bCVHFyYQc5H6Ezm+mNHD03wkk6j7
+m480R07W+QkhCKSnJVvGUvBBlRzDZDeeaNvGwHd0PT2wTy2HnkWtuMhkklgK66LZ
+BC6hKMJnOxOpo4YaB5V7rgiiWQXGCiJrYk4Y59qslhcA8/XJNJQLb+5tUzHJCBgj
+Qx3GrzzHn6xmZ9A0PtV9dbezpCHExoEDwlrH8dllA4YEY1mhsA0dIPPsj4Mi73vz
+nrsvJLs5YqABDfroHBg+ShQ0IgOs44NI4F8CIIsVXHQ6z3KS4MOhdxigYOImz2UG
+gJAuBhpsgLrldXnhNQ4jLCUyTxyhrIrwuyYrqo6MJzQ2Wl3AdDzKOb3Cydryz5Do
+pHBHMKBNdAOAdXJhYMgMb2s9Fp70MSClw9KpTbdzhHAuMGAtobHQJ2SURvgbbhyt
+BecsuXl+2jKigzt7goBTjmpC8RowanZdxJOhWjwhwrm99FSiJ2OgLLnm8pnjT1Fc
+CXCc0JaZijcmjpDACeVTrZneXxGRA+184I985kcHQIQIEFMgWfO635rg0SZSO/at
+HtcUKa3TZ8OJoImYsgRoKAhiZKIBUsG7yTOFlDFncMU9EG4CMLUKMxbiCaMDYdhs
+JSKdyLFJCQmviCCLgGuUz81ptojXx2oe4d2iHnAkVSdhzcfH2K2UnIQ9u0F30MHB
+OBY0UHMYYjgCQTAWMbwXTZQXaOgnfjckJ+BO475Zyfo8/R0NlEMBq8c94sZJiNrn
+yJ8OoMIDQPjt9uJK8Rk5aFDYbJfWSynwRhgIbQoB0+IsZPFGy4yADzZLYokaBywD
+CRmTeH5tmhDzPmA2rD32gaqneqHMNqA3FgsMePDM9KB69ebN4HOAhc26eoGFI1QJ
+m898wsO5qZxBxcWUgvtw5Q8AMEOOJJ8HEEk6B45ZyIoFaB5KW8FLb/M4KYSZIP/T
+y/DoMk5Ami3wPAH8EyWhTaUsFlQ+g6AEFdgHlJWNLpOCvdk3q+hWdqbTJWRS1dey
+wOAQwQUmsxpFozUQbFTRcPzhmHw0BxsEHFHdI2kUHjDkRPSGAp3SUo8BEdPPPTw4
+44KbQ4SZsIKdYe3WCo1EtM7zKTu1VAoZ7hPFDfU88SlCY2aHVSnVAOBA5wzuGlcH
+Rs8STcvGCu0xIzUFjkwcvlheRAzgRbJkzf/N0YjQwJYrJ16VzC1gueMTW4Rt5rYT
+IRNwYQYtHOtSD6ShBHOQzP37jm+TT/gvnq0DgyDuezyZv7FGKF8j4kpFLwakHPsy
+LSDphCyxQLl7xgnr+Pl8wbTsF8dx04kwB75wFRLdNRIBmhw2pH3UCbB9EgE9z5eI
+BPN3vYxzTZ4nEgVR4qoGQtM+BuGwlgV1WoHG4EaoNASMhGBgXYFRVYIXlASg6LSg
+GqeHmiyAsDilBBOqQsS4Og5rap1miKqAdUA6AdYTWmgTRQWeULDLBzlSEcEEDJbB
+4nTaBTC2glnEXi2haNhLoJcdgCNAkhcqbCc44gFrBrre1RE7eydRrtb9wdNITgOo
+j4QWulZiLl9z7V6DbnFmgcimAjOFhQs7UI75C551aKdXmUEHKSvEOCldH1YzE3wo
+E42BxwHl9Xk7YSa0g1vV9CriIWOztgqD6DgKN3AvOkS3ODdnTdtll+abk1SRIIGv
+fALBUOBR7ZFBZ4BUpBnSQ4hFHFEZ473Y3P+zY7O60Rs1LaWqHHIcwa8txlB4jJJE
+w5YZFHWAZUEtKyoIGdMwDYlA+A9mFgSZbOw4M6OOSmPkMl1OYzvpRASmvvXmUjTp
+8joGG1lR1cQpEEugzJBUyZnlygzInkeR9IZ+wHyATZQgPmd1ZmIUecB8pAzd6P0t
+AUK45zvDzCusNxdKPDohseJeeAI6ZvadwEcFQCRCgsXNcDfG6wqIm732cGQgwkIA
+SKEgydIjIZQ4a2thurU6wysrTQQglytZnEFtKoQOjdqfOmiDah274ym7EDxm9s9L
+CegGgMopkIt4LQ1Xtb9yBS7B2LUpK7hUpgHQVCXmwmbMOQqGHhGVvfpgEjVDoew6
+qNbwaB5vajnexW8pSBC73poOsSDMENqjGDoVUvvCS9M4jdfRrEmuQYwM5KDSHMK3
+B64lqG9DhQ0JoNQHlDlAPccRKnfODi2TDOoYNSZAcBzrUAVglyHGRUI0bMziEWOU
+JYnAOUMt6Rku3X2Za5l+nJIHiJXNq4xzccGdzaqu4qJJiDRBAN2TBKurol+bv9SB
+CSAX8+8Hl/r7sZnxy9PYe6Z7cvs98YtZ/SwPrgMD9OXynBh/XzxwXwdWFeXp/iVD
+kMgNriWpJDP1n5azCg6/xxxEvwpxkfhIP9s+2nQ/fn4vF9+jJ+ngfdWL4CPb5czf
+UQwvVtZEuz7Om9iWrwP/ePX0KAP0+V9inRoSgybccCP6dPd+K+f24YnQ9YpYUGst
+TKKFMYQdT2HL0fr+fbVW3qvv1NLVbRWSUrVJUxgSVjWktRaoqKNrFWmUUVMjUUmp
+li0zKazDabQ0YKDYxZMGg1BpRpYUwpQCMhoC8nsJe4+Dy3Xr8S8ifkOz/vaP7ETx
+FiYoqdkOeLbBtH+bHadmz2QGsccbGX7OU2D+LhZDxGPjMsOyV+DZO9PSeDPkEcZO
+SS8UzBJ+ecnUZhlZ9ZyM/ad22YYrjBcAz/3V2B8/JiuT7ED9kw+rGGSGmqTbJiMm
+LSysmTaS0aks2bSzWlZtg1EpSSYlNkqItCalNFstNttqaprSmpS0pqU1LNFgKpZV
+srWWrM0lJM1bEW0qbEmiLVtRGZUbSprWbNaLUqaks021KtbS2RlllbMsywtspLGj
+SaVEzMYk2NmzWptlrJWmSoRZSsptlZZLRGTaNKm2LJmmyUmSWRk0WpqlUZJJiWlp
+tkjGjUy01TaUkrKzSlLTMzAbNg2KlpJMl63e7/d+ENF1fgGLHuf56NGdqOvg7hSN
+iHHED5NKzQnm2yaAQJTIxieFJM3ij3X3qh5AHBhk2riuNRvBd1dJNK/o55W5e1NX
+ks/nngBUDz7INtUfFdK0JrgNgbjAdgkJGRczQCngL6Zh4BT2UW6xEWOCC4FzQuaj
+OxoBErUsV1z6K8cAICwJGRj6fB5iCC6h8QhiZB9qLr5NFyCenPzIPnc0WwotMInx
+4sAoHfMU5HgU6hhRBkppj/FgHNLt0ubr4APQXPI06DXqSSyDZid8zuPuLwXKN4cj
+jq/w8zETQQQXn+w0DiEJEiKh7fzQ5LMfgQXmXrdtA+sBzTIigGxVCwsOYhmJycnC
+CGplhE8/sdAhQXcsIRJFJISEJE8flHQO6cgR0ZCoE/TcCd+BBP7orIml5zlZgw9K
+QKKpGkiwgESxpnXK9pYwUAa89ij5sPoUYZjQ0lyAcxQc/xtRzIOJISJHL7Ny0JDw
+BwZa4MDUFR8D5CCCwzTyVsZejnQapAVGYICC5dDXtXOsmZXMO7mFWN7P56mEGIAc
+JHHBsharUAUcAp9UrviBIAxJ08i+RBO3Ah2QAgiK4kThwo8sDCf0aftxqENQKMTv
+TZBCNMVoDJwdi4fVhYNQyMy4KjH6SlEAvexZaMCmxViqK0e1JpDA33Zg0xuGQl9E
+hiQvQ2FHNA6XqGDe6CB3obIHAhBD+L/2H7JweCnNu3h8F/bQAgQghowH1UAW3ICg
+LRMWh9MD3nL6B5zvW/rtbABAW7j9J/ubhTjE1Dh6fjPlrh4F1mHx9l6oKaKdL9MC
+Czogscg9WEHR1P1lXLtPyv2av6+Uc38L73W4ynzSHQzT7n4a9fw9G0pHvHQQT3Ww
+CpsYtnkcGJdhEoMqdwTQQQWf8H7l+Sm0erEmuPTqAC3f/RC5LqgrQdfyPN+J3eTy
+V4GlQVzdO0KeqEArm/KUORmgILgIYcAUkDE9WuptiUObqmYfnmExHY8cNvsWx4o2
+QtFrwFybGSaII/YzOu4hsM00VwmYOAJQ3KQY+rag56UiZKVHIpnxryUn41uF8d2K
+fszLbyzAkMTuQc1BJQQHPuhBBej0s+yiFTpnRcrVGp26/SPoGgGLAjmBAhpnAPYi
+hGHgg8hN+hAh0NObgHp2R/M6Jo+S9Uw80pUFedRU1bYFRVog6sTPEHADwMAG0oUe
+ZTzCfk4pmd1M7BJIMNGsaaugBm+bdBpLDSNwIBiBVKx5dQgre1pCrhP2FD5vX9bb
+a28/PP14155vN5a8GIiRRgLCSaKIJMBu9u1u/IdZNWhKp6tcoZGbueNNIlSQLYOV
+guF/I1QEFvm6liJuQ/g648tjVjId/WMg6iEQnkcuhltYdGxoELryIDySIMiK9wD4
+MbBiPihigLkeo0OhARBcol9jMSNhf2ITsgILYNseps5hodZnnUYfDxJFi4UQzXNx
+EsQsWIsPUhf4XvqFHwQ+WPfTBIHct1LIZYv2+juqALF8D9dhxOkM18bdDBT3QEFx
+IIWRNxv+UV8R+J/0R2XJbrEIOYHU+pkgRzsDEdIZEebTO4gQJeqofJbdkqra4esL
+roGjHL6Gsy4rZI+PElgZlHIH1++YJmDEhF6psaR1U3IWVmpF3VwE9oiTMpi8Nzz+
+aHRDUDwW+WIdt3zPNOewJzPCB9E6jmCYHFX8LoITudMz7/N1SyV8kTcL0XLh4A7N
+JzfBgyjFkYbKgC8xPTQ2NEVHr3NX3I8oB8QLJn4JCrIRrrR5SSiELOBCqIlECSOq
+AgtNF/5UYIUAbvmgBgPL1xIT9UkTRqqrX53ixpCNGKHEwP1PwJh+ma3ptrBwODbq
+SORcDEiR6PVwOxokOUEsjBbkzcaucQzU4IBkiIQDSXJdCotjbIzzDs8lfNscXA3I
+EjvBoCBmX1Xq+IE6m5+HREB7xUkefMhRTIUUVEoGUY2sxAvjsdB3GZnYoMTuuOZk
+0IILqZh+sKgLQ1ULBUF4SYf1u+nDkki7SjNoBQWIGv3PuY3TIDM1QtuJ3SNep/DE
+5GEdQMHhYWdISJCEh+RRD7S+bd8OK+sbha0qU3NES7e5JJCEsxa4lA5ucJdrboo7
+v42uXj7XKXZXimppWTWQJDU2Uks0imZSWU2bLZWUpEzCgmWQzZKmlstNa2pqlKaa
+aU0pppMDbLLVlqzSSa2lTEtKzZJmtWpNSkylFpqsptkZrNNSzS1S2bNoqllIpMmS
+lmYDKLKzVm1LKVNkglKVKmyy0EstNixZmkjEiWms2xGFpVEWVNNKkSaWUpmMKLNQ
+l1leHUD7BQQf0nxooh+rfDYdYFRbCkgUOlBI6EukdLgodLEh6iosAIZUDGcFIBnT
+5PfxeXIybIEK3a2JhwXN4a5XZyCUN1QHKuKm53cudZGkYw+CUhgAg4jiFUxQcoWX
+ZiDnC1kcAxisjx4FhBuB1RLpkW/L1JdQMQyPlqBhAGDxWuoWKaLLctSBSGSu4x/U
++UGMFxxCH7+CQBDUTBsMAfQX99QooSAcCZEiD6vqNtZoMtphkjx94b82mEcdDU6C
+GIfhpBNHRGdiSEhKQ5wXmRP0FuHscjHIQQXE+/JA9QIe5u/rPZ7iGp3RjqDlESQZ
+JCQm/LYfclj52MSyQjrCotj6Nhs9YNtpjG0eYiFHs4e+RkLZGv6lQVs25H8UcydI
+dBwSSJWZ2GkMV5JBvs3IEHqRvh5VCbiosL1RQbNSevAFkgodQSGXyDwMAKI48pbY
+nKYY5o3AkxfgcNu/2TS8/z4OpVwpwYLoslFDS0dpbVLklyLktcy0qrt1rkkVDQKa
+U5mIfn7qbHUwB+pUzzDYgdOwHNMsQqIeAQgWJ7CdQLne/Uch/L74GbnkIeSHVY7B
+6HzdzDBZDLh9FDDd7l51/E5mJCBgdFYeAu3YglszcA0yVJwA+V7zU+xXQdNIJq0w
+kfMItgm3gj2uGRgGUX4BpO2ZVeDftfXE9vP1ve16wzwEEF4VAF3VrV67Ndd89m7O
+GA6EokveXN9MfaQsQ3ZZKcK50mcwJlSsZTgk98c5KYw84IzEZbkvNTsNqzPLKyHo
+Px0sFlfMO5q7Gy/RLjgGa3WwaF0oI5J5CEBrzAuFdT9Mc82Cdw1XLYdAocXnucxw
+MDq4Gb5ImDg/Y1aNUuciSSLGs30w7o64wiPJkCOJGESEZEDZGBLmOHlrwGGQG1zj
+MtuCoxq7RpQlgtQ/YQ5xHKBJJHiia0FHVsRLGQe6Aj+2KgIUQACACiJEFxCraZaP
+BqeGpHqJ2lIlZ0RymyqrLMZVKEz6wYDwNnVwEvXcGMYxgkEpwJK03QsQ0IAGhJqy
+CBkmqpjC2e6t4I+Zf0JUTC8cgiBBIMOpm5aNIYWCqlcG2GZjNkLK8i6B/LSEtoDR
+RIJtyOGwPFu5CEb0Y2d1QVrHSAerk2mlwOR0esAyQ5waYkWyRMAgkNlX1WA43hGO
+YdDY3OWXJQzDIuXC51atcCh9k/jjTxk4r31uGHUMNV7DyEEFu9aoidiNHFzHFW3k
+pl23DYUqswRQLrmUK++C6OIeCEEGO4Oxqcy5rvYfEQIEszhUi+UBMa/NHV+bZCGB
+BmDsfjN+oGAKjwgfAOjBz3eAT0JSBhgZHiXA7HejAOj31UJ0cC5soXLOxcOBUy41
+LJM6Q8Jwpx4F2KjgcPvn3BRaXEe2Z4vPu2/yeP+aH5JvaiC4fKQAcndicHNDcD9b
+ShgrZAQXSGTpCSlPzKD5gwnhsz+p8ujoewiFBY3pKLSeXXMDRxzJq44NJzlzG7rV
+oWrj1/nLbhdUFc+SIUCENGZwNenyhKIbAqfWTOCRY+YUj3gzmpUR68AgUjUPy+0G
+2hIxUaJCNpMRpoFYjY0WIzNmFoMaNFtEYklpFixGtGxg0UUVJoKiwYNaTRqTKQRU
+G1Bo221i1VFhYBqNjRFIKqgpJIRS7/L9Xk8v315svJO9OR4u/ONn5FGPE3fMqdtS
+xkZBu7kta5NbuU8MxyZMYMgmsNmMhnKfGmtyIG2LzBpqWYIbdmCYi0lYLJxwCFFa
+zJE6zEudHD27ZzbOeSgpk/HnkQbT7twqaaJXNvUzMuUt1hyhU7ceZcph42+VTlXU
+cZ9UZZJyYojLjaeJHfJU1UZUEmBfLumu8yW5skuyE9uh2BmVxJZi6KxaXBNwSolw
+BqBcQLj3ucNZIYZLYtirLu3brW6UYgZgZJiDIGiwpsgg7g1AITkgM6FHITxDDnGt
+4SDHzZbL5s8fec5PCq5DOzDRdWS+0h5Y2INZak1D29cpVyb2aVrV3Wlt7rQhLa3e
+m3ZwPNcXywE2Qesk1XN24HvZ2Xa6nlm8Pf/xdyRThQkO1NjuAA== `)
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/mandel_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/mandel_test.go
new file mode 100644
index 0000000..888c5e4
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/mandel_test.go
@@ -0,0 +1,41 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootuot, tests floating point performance.
+
+package go1
+
+import "testing"
+
+func mandelbrot(n int) int {
+ const Iter = 50
+ const Zero float64 = 0
+ const Limit = 2.0
+ ok := 0
+ for y := 0; y < n; y++ {
+ for x := 0; x < n; x++ {
+ Zr, Zi, Tr, Ti := Zero, Zero, Zero, Zero
+ Cr := (2*float64(x)/float64(n) - 1.5)
+ Ci := (2*float64(y)/float64(n) - 1.0)
+
+ for i := 0; i < Iter && (Tr+Ti <= Limit*Limit); i++ {
+ Zi = 2*Zr*Zi + Ci
+ Zr = Tr - Ti + Cr
+ Tr = Zr * Zr
+ Ti = Zi * Zi
+ }
+
+ if Tr+Ti <= Limit*Limit {
+ ok++
+ }
+ }
+ }
+ return ok
+}
+
+func BenchmarkMandelbrot200(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ mandelbrot(200)
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parser_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parser_test.go
new file mode 100644
index 0000000..7848cad
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parser_test.go
@@ -0,0 +1,43 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+// go parser benchmark based on go/parser/performance_test.go
+
+import (
+ "compress/bzip2"
+ "encoding/base64"
+ "go/parser"
+ "go/token"
+ "io"
+ "io/ioutil"
+ "strings"
+ "testing"
+)
+
+var (
+ parserbytes = makeParserBytes()
+)
+
+func makeParserBytes() []byte {
+ var r io.Reader
+ r = strings.NewReader(parserbz2_base64)
+ r = base64.NewDecoder(base64.StdEncoding, r)
+ r = bzip2.NewReader(r)
+ b, err := ioutil.ReadAll(r)
+ if err != nil {
+ panic(err)
+ }
+ return b
+}
+
+func BenchmarkGoParse(b *testing.B) {
+ b.SetBytes(int64(len(parserbytes)))
+ for i := 0; i < b.N; i++ {
+ if _, err := parser.ParseFile(token.NewFileSet(), "", parserbytes, parser.ParseComments); err != nil {
+ b.Fatalf("benchmark failed due to parse error: %s", err)
+ }
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parserdata_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parserdata_test.go
new file mode 100644
index 0000000..113e5e3
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/parserdata_test.go
@@ -0,0 +1,245 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Input for parser benchmark.
+// This was generated by starting with a the contents of
+// src/pkg/go/parser/parser.go at rev 9b455eb64690, then
+// compressing with bzip2 -9, then encoding to base64.
+// We compile the data into the binary so that the benchmark is
+// a stand-alone binary that can be copied easily from machine to
+// machine. parser_test.go decodes this during init.
+
+package go1
+
+var parserbz2_base64 = "QlpoOTFBWSZTWd3QmOEAIYdfgHwwf//6P7/v/+/////+YEhcAAAB7hwvVWWaZT1X0dt999296z5B" +
+ "3mcQqlBVVVB7hnASWJoFGq9jlHvZHRbdfIB0Hz6fW+jrz4dueD73be6c33tG7la1O9d154ntzzk7" +
+ "jnU+O50zayubCulvgBm7rou5jleOe730dzX2sUbWj1u215X2PBXY17GB3Y3NznVW7ubOuu5a5wHc" +
+ "d9h69Xtatru8+D21uj7bM3lBKdRzPul3bt3GUtvN7z1PfCU0QIAmppkxQYg0Ap5NQZTxR6myJp6m" +
+ "T1D1NMgYSmgQggmiajIZKep5R6mh6jyh6RoA0BoGmg9RoCTSREEEAnqnpqbKp+alNk0ajR+qeiNB" +
+ "k9TanpMhtQDQBJ6pSkSTyPVPU/VP1PShkepoaGTTDSBoaAAyANDQMIkRE0lPTaZBTyYlRp/ok1Pa" +
+ "Rkm09Gk1PaptQAaDR6gPUESRAmQQ0Cnqm9NNBNMlPyj0iPQyQaBp6gAaaB8HrtSFgsiaNsTLSbZS" +
+ "paVaq+DW1qDTQ1FEYixSRiwlmJFRJrBmbIYoNEYoylREClbZLFikJKNRBFApgUQ1GShKjaSyRCCG" +
+ "UixqTabS2lLZiEgaKDZLMoxFY1o2LULILGDEJsWwMhbMzWlpbZm0bCaSS0NlmDGZIiRWIoxorEiG" +
+ "IxTJIyIGU22xsKzSqlMUUmjYE0bTGWaalWxLIlMQqECLEliKYskmLSSjKTKRYGRZmUZpARUKYttm" +
+ "ajIMrKGY0UUglEiWbM0tJsbGyzIk2myi0ZVYlsNRhGlFhJVKmwxloaVklNFBtDIZTQkyhowI0Qxp" +
+ "JTJsyVRUijUs1e9rpIS0kNLGYkko0WswwxrCAwJFBiLERYpFI14/l8d//VUo/f2Ofl/4/PMmROiP" +
+ "+X86qHV/m2eKhwgQcW/w+YWCErVRZu5/WnEVaZnt7Tfo5OP8TQ/6bme17VqPoaBMhDbuEqkuzjiW" +
+ "z4vygpH+2bkcU5nBikvEzgwxXZ804V1e1KpfovBAJKnhrcaHdoN4aEJHqHLUlmyGcSUjUdCvTYRP" +
+ "65aIz4POFpBLH+m+1Lbs7kPa+GjGbi6lF6kRnzeuKKJqJcsR2+EnuemMS9kr4tXWry3r+bgQMkhI" +
+ "ZkgILVvncoXREIltDqJkTlIBmQtrNEYdUFfdE6C6Uevosypd0519H9t17FtHW8FHImhH595l8V5y" +
+ "Dy7pYjFXqJ5ud+fYaJuGUNoK/3zpKZs3XTCeRxe50nakx0WoD9OZ5fgiko2ifKT2JRWE470vIn9q" +
+ "YqZeDApYKszMZ8Mp+S+W5s96YNXPi2dlO/D+1qHRSrLkH4VE7L5oPiWGXTwos+dnwniXQoVKJu+K" +
+ "Y9bmXzt/02qIskOq0b5TG05twenXqbgV7hVAkTElgmqsqORvcte/dakNMsd39HphWvVaeJ3rcihv" +
+ "cJ044ShoPW1kUxBbyYXSVcHhwcPSlRcSVjjMnnOumoi8tmS0XNbV8t7YwYi/pxq8j4IDzF6Gjjac" +
+ "8IstxcUEu4RJ7FipOLfio4rt9s7lfyvvwluT97uTcrpUBmf+k4nmsClh3fSIXpUhCQj0vMkt3PMf" +
+ "iudzHKBAPMXLy7ghISaEuIIZU7ueq2srC6YYkS+GIpVA78WOscuCQLNvB3uP5O/z7mxPA5zkIjIv" +
+ "KdUOFSCIx8N/Dub3Ur4WwQSti9vd16B9/Bzk1g28aiXYmRHTrN0J4cW8xmekkkaIMQXypKnBPZeW" +
+ "OTnpXqdzrz3NXv88RyB3SuMMy9e+YJ0LfvtfRletL4X4fU0YyG2EurWAFBlGvZ9Lzc161b0vZR3B" +
+ "lL54b52XxrzvXeyu0qCh3+Nv1LgzQhtksL1Oay/Q6uVSRCofJ3ZjFUiG7BtUBQ3ZQrIHZJxdYAou" +
+ "EFtGQkRJCQq1JlE0w7e/NTTmJ5ifsE62XbIaTAca2fb4+p0d8L19KX8vFwTin/n8OvB6c+3w6PlS" +
+ "2goNsUIjAKysBZEGKrGSj9cuNPj5nrOYVHPsxLdGaeVHWXgKPR3anI5fKwnR8SM4fFetyzwPhxw0" +
+ "0lGM5Y02qqy7YY3+xFTHU9QtR7daZLEhpvsY3iDlipq2XAQehwfn9cm34kA9P19rUJ+RB7funX6O" +
+ "rB5/xJ4dxpknnVZFXSwLq0tDC4Oze4TN2dOHZ+HL8OJ6n/L8WuPeXeMpMQqItn4ZQfO+L6Ptnu6u" +
+ "udDLKkBnS6yOVFVGKAsixPT+D24mcn109jn27PhPK6x803RI7pvAz3Q/nYYY74mSvWccNSVVSvyz" +
+ "c5IPV1UejZKjmnB3wuXPfG8LTTGrMkIz6mh9EbgSSBOQqmfzXu/57PRZlKcl6buNSiCdgf939gq+" +
+ "zhn356ZdFGoGUfVHCdBp4HXcfZpWfVbdNxh1rxI/RvAK/e4fAR+AkS75mGZTvK5T2ob4g+HlN+LU" +
+ "ednbpvXKTzu+BgxnhWG7i9otZECZps3pIIspDTLQ0P+o0Ryw/UOpt+F7zIKwg3cxA7UQX8rxDUxI" +
+ "Ub/+uw6Qh0xwieVzEaeQKh8s5uI1o+buyWpo8kZVwjBN8JdsHV4lj5tdUIiOuIqskenyFpkcNGgK" +
+ "cV1ohgEbXdcF1bm2LHZwKinccZZqRh4EXGbbqNuTSUTM06DGbwI3IfZcrrVlRlyGvUPnKeM2tG+p" +
+ "U5Nk1fWcKXovwi7Bpm85156nFylux70tJGHWaxNqGt02UGzMM04bJc6GHl57m9PfjBeQ+vlgtDBA" +
+ "KJkoKJEjXjnqvAmY6RkaCUoeo1mVlVA+uUmbbBqU8dYZIxiwRH3Pxc3bOD9uB5Jlka6An6c9B9km" +
+ "OnDL+FHQTYNwgH8mavZz0iOu+Ut8/J5ZwyoIamzhyxBs8262E1X8Xfhle9iE4rVPPFLG0iTioWAU" +
+ "d3xVBGn0oRJqbxtUaxhpdln5NtolGMj59U8pg0/RSY4z7US2Ms+4/ppi54Z8T9x34FrNnEaNTupy" +
+ "0wwbD4jnv7F8vm1WllYykpcbxM8YVxcrK1o0GGUBvVUGqDpjwLUr17oxmaKusyyrqV4yu76rlNga" +
+ "TtCAVGwYMvm+SLMenn6P375gmvYRlpqskpNDxFJcfbkZ8bux2QkkYKLPJlJSlbCOPNDfSULNSdHM" +
+ "12MvGjz5tYTNEbhq9fk6J0QCf04np5cuTvdC7SzdPmMDWTDxiD5exXpVi41UM6eV+926tnWjqo1q" +
+ "KZvLp3rjuvrmxbB648TaJlIjEgjUx2qKW6HRaInEGHsXUxFRTPPAsGXwgtoi1905O44+FkV9ctb8" +
+ "7pZtlllncqNGbJqP2LVNqa9WBOlqMdkm1w8mO+Ln3BLUvtWWl/CjfABpSq7mjGtMdPHs3a9OeOVw" +
+ "FHvW2fQeG243Jl69jvgx4jbSeVZ39VcNZNO5EiPRfOTlBHsZXX27TyO0b+abrFZ3Bwdx+c+uRVo/" +
+ "TEFzLJ4uXS1FoXdJblwzfjW0rcGlZ5Jqs3Gb4iESyfmdVpU6i2DtBPBtsn+nlb95Y0pWMDBM3ZBZ" +
+ "pyIEncddO3bafpssEObXLaLNvraGuJMzgiNF3+t2uZC633wwUji1sLoiU6X4kuZkEjKHnqmi1zXF" +
+ "+dM6MTtO9N5yDve47yIt/CkoVoTbWfc9E1Gs8e19PLxPS0i18ldi6xjw2bsWfjR9Dp21w5ImY6xr" +
+ "3J+BF35JgmZMT8PbEXlDThrTfEMkkrCcD1u+XbyIkkjGCc6Vc2Vr5X53XPuwfOuM31yem0tXg9uZ" +
+ "1kj2P4Hx03wa13qdX0xDFNlPCYxkY+xVhq2lCzma5tkZ/FD3755LyZbdshsWTGsbInzJ39+zd/Ly" +
+ "PMkJ079dteGN01Roys7oKtfDIa/N26YWY4Poq35WHTCM1DF7S5me2r5ahhiLl0ch545YQ+r57a4+" +
+ "Ls9VjY5Pswwk2x9S45uMQ770ssfjbRB1U2hF/DV8nak751LqONvJs28E0JmDcmEwIr4sB1uClx2b" +
+ "PpWuRnAWq7oEmSBKbowbbW2lGqi1nh35psMxUZ4d+FxK4uHVZNA7vU5qm0rUs1IoT9jPLkrzJ83e" +
+ "t1ZM+BwItwHrFPb5jtL228eV0ZUpLZphfFKj2DCkzbKiv1ODiobghZh44PzyoxgKV5SnP3VUGTRN" +
+ "h9Nr5MyMQvBNTHpiwN1N4241qJaQRhUVtKiMhjJjCNoYkMErArCTYOiM3SF88PVh9B9XSdDzTkqF" +
+ "hbUSnyoH1EwYMUaOhcqJmWVqsWHxhPCckWK3GaoqMmowMyzTBWal1P5eL2sVtZ+drjsx40brxVOg" +
+ "xhzdgFm5kg3UcZubj4zvW6QQgvvcd3x612pOT21AWT5bhwppdXYsSL7GRd0DB39io1hcZp98dpdP" +
+ "I7tjczPaDZBPL3EuO1nUrIw7csHF06ZNzmmUd+3TFNPvpr63hVjYTlSF4RbMRaymDlUJwWzYoxO+" +
+ "Ig6OY5Pjo2li+/s0+z4u+7OhBI5khOnopHj9a8efW8cp+r7kZeu8s3bbvYS+DWbWy1roJ0p1AeY2" +
+ "X+fziwq7PTod5KluzFOwS5vjjtukunB1xtG3rkji+868nZBbnTAgkLNN9Ezlg98Zlxha5827EPn0" +
+ "5OW6tutYMa9O+U5TiKz0ggzo3G2J1u6vrY40j3UfBNuDg2ONsRwUmNyZMREtEUZK8Ifne0GcxmXx" +
+ "L3F7fRIQk3RU2t4jbit2VdddKuMkXMTSERChLhN68Hj0bbJ7JYxZ8evJ8+Y5Lg119jsTYSQ6dxXs" +
+ "VKvg4DSyNLKMC2MsbYLARKFWKlCw5wzKlkQYWgttGacw160+Qze+GHCZbC2hGlGVjaX3h5YYzj3f" +
+ "DFYvzyl4YkBZrrrZtfQbVtkyqYQ+rtBBDGBnuPOcHrLOPXfllLstfKRrywI0ctF5F0qltBsNN9Rh" +
+ "msY8es8xjHtcrxnobZe4k3Nuc51d2e2RHRpNSdoNbT25KkUrQtDy69Wxwnnyc1tdraRFtHagZVH9" +
+ "q2swXNQyLCahLQC4szGKaGZKqLSiD3FjPm/7PL5ZHq/XmHmEJ77utU9tZ2zp/ODPCfhI7MvpP+fy" +
+ "16rtvaad6gz2zk1d2YaqMavtFjzK6opMh34RTf/flWMJ0d7tOtpgM0vJ8dPn/rfB5LrZc+fPfnI5" +
+ "rc/tsb5rm3jyV0qOxk6ObY8ZOaTIvk1eLm6lLtZNvtx1laKDXauwgE+92StvSXJZab2zM2l3uYmi" +
+ "IVzSVvVOIE4TEEKad3HGSKygKpCaSo7ct+/dUzPu1tE3+lX/Z7WAD7kwJdnl+r5V6jq7Plwv+rjb" +
+ "GTGL+z9mNjB3cVT+p/DcR60xRs/IsnzfdPSZMlJLJOVkTvp0jO+LfL4X27EcdvPDw3v6OjWSz+TJ" +
+ "Z5l8HIoiquZXPPLqmEUOm39RGa3IwsOfguiZmZqIF2DsDpJJiTapSFYKFGDTr79fD/h/Z/kw1/A/" +
+ "zxQAZAP48GZxmZj/BHm7jPl4tco2zu/RSCM1VNCZI5cwWyltz3GeHlL+w1PK7o8fDTfJUfwq7AqK" +
+ "ElR/1UhrVBdYNUW0LBlGoIo+JbBiaGwNIKCvd/VrVuIOVY+HGZJzZzhRE6ckuA8ticpZOPpOuuXa" +
+ "KImu3UyMxO1amcSxC8mbshm5/lIYjo5kHcND4/kn8sbsRwh++dFinScFgHcTjpweH3aAkjJ7NZJh" +
+ "ddL2dOl6oL1jLNaYM1MgGs52V9cDhBLMwwtZ5YpSzsDNuTpQts24pU5iwhxqgIHKpU1yJCBXnBEJ" +
+ "mSqlV5u7exQh/p1mcnW7JmCri2y1MbKmcokR2TAXipUQkC6CwwQ12Gjnm44X1tVZUp3wlIdJOO5m" +
+ "wrczzu+aFaUilZUS7dnOxbWfWcQeSZ0hL7XHvhkbDzwo37Y5ckj7LmXmHin4QLlw9Ec5/JGyztRG" +
+ "X77Pgow2DsQ6pFw8CK6PUTSTZrWK6ms1J4xnhI0q8I+Ssvmmx/P/r7qE2bRAJB9mf25A5z30NtnL" +
+ "6Pmqft54xt9X3KrN/NSEF1a4R938Ou1vHaOqTRyvO2h+ZZqd1LGaryhzy460Fwfoi7DtiepNdA+V" +
+ "zXPjwfHd+wQOyGMkj0raTGF7VnkvOqpmpZThtUdNn0VJPsKqbdOUAo16juWVKpvxIwUefdTGVI2W" +
+ "xt5rY2t2viki9JK9xd3SJIkOhySAxWJLCGZb4LrTCT3qPu7MoTJE10zkYWgeyawo1blLhbkKGHiZ" +
+ "SLONHph0Zmnz1cYA3RqHbyrB/NqTf4rxWClAjux9sybomMloiRMm9QlnP6Jj5HvtjsYF7il7l0jX" +
+ "MtL9sUMBEpx91hbl+/jW3jqZXfdEZMIOccK6re+rHGqfbGxjYnnDOe8T4OziLqEn8cDo8U3uZNI9" +
+ "+rZY/1+m9aZrGv2EaunZM0m5cU7X1POp5guRbRg2tot/g+/jYyTAipiYd30IhHmjxz8Zc2rQjdcb" +
+ "5CZdXH3fH4T9H42O/j68ZVXgty63afB3lwUIheY9TdWksCKNItEw8L7kwgGaLvc85h6mRaQPm7YI" +
+ "mYnovikrbjd2eGmWNRN588bS0s7T3WjL59IZlW4eJhSFGPW6EDovZLjfDVL74o92s5lyAyQ4INyq" +
+ "gVzWv/j4aw+H6buyxIjRdfRDyZb+NHWrsD23UhRwlyzY42awYWc6lfzag5F55eStTf9rRhuzVROE" +
+ "jAmYZ2bWlICbSehLazA+NNsC7SnKNbXXUMrObZXU0bFu+phdvVja6/DNCQkzS4XqDWlrDytvLVIO" +
+ "fd2Xj0O24X1z453ylFk/j9ve4lz+B8utfOXokeilpTm1L/zvXc5+pNcY/uLmvZPpsezuc4Z+g7I8" +
+ "lVPy/Et9eH+Y3vZIZe+aB/CTMODCDJOMeDdsmKt29WEjDc9AfZ4u1pPukz03zhZ+vzRdmsXjjreU" +
+ "wgzctKJSRVDe5xLLIZmbgWLsFfHqm+F1I9+nyKo9edkYW3R9Ipo983Z02KIfdeHBkMHHn8DW4nz1" +
+ "+5mgdApk5IURBIgEE7boPGAFYAPquEaBic/Rwmnq20EA1FiEVQjBjJBIBfYUfkDwGbkAZUUtZlor" +
+ "CGHFFIkqUrRhxgMJB68bJedguTa7L1cmjNiwpEjFYmlAFEANGhRu+FBdJgUlb+itYpLhS9e+sqou" +
+ "8GwAGRQBD6gRE4/rD9x71IXGomMpBwzAxWCKQqUBQqNKgqXLiV3bppW8JdCriy8WRjlL/y1ldMRN" +
+ "K2pRQFbRHHIpqmjKgqoiL/dcyukplgqt/fhMTEmmVy2jHGg399Na2lx0mApifu28Z7LB3WyX7mAd" +
+ "D99Hq/Cj0hGInwCg7T8PY/TDUMet3DA3yc4aFiKkE/pSz+ovbPD+L8fxI+cfp22n9HmdfqF67pXR" +
+ "+uPpkTj7JuUM554R0uKFZo0uwL/244GOE/tg+zWdJ3fbGmaQg1dnHTLH4+KPnFDj9Vq1ZNL/eozL" +
+ "Oipce/ukJE/6vGGCvqFnbZvqQ34x9B/Cr02eF0o6TvQP8Djg+slju2sLO0IOiOv32aRo+4034LLE" +
+ "svPHM1XAdlzu7umNN0T+MWQPqHjxOSv6tjrUsed7MxDZ6lscn38Yw1ZDHN27SuxtezttN+ryiaRO" +
+ "XO4cZxK4nG9Sxll+s7P2/WoC06HgAniO1M0rO00euOEpcOtyWHtwG/d+iPxcl+LSkORcLIsRkQRY" +
+ "xZkpLTK1Uf7q5MMuiLCRIiIxg39+YMUrdMoqnzK8S9SZNNjS6vRlVG0vLrmmBkmElFkgUhqSZUoy" +
+ "UmokxRtubunYNSN3r7eVeSuxCvS8sVJUbTZpialZgpN5eSOUARUHSKXmk/EfaD1QAkB/R97g+n6D" +
+ "26vxDEMzIsfuDQBwA+SQf6mQD7t/2mqYNm7/n+41MP0TCXIP/o8z8QRjGRgqxFWaMY9g2K3/ibbn" +
+ "CVQUGLt/a2uMYK9wdkaT/RV/f+lsNgbDUGDIrtjJIGxuLmjHdRBiSlIeBRA55x/gJCZKPkGhb5gI" +
+ "JJWoXgE/xQxRGsG8zgwNRkv6s1qmrMuJy7kvcz9XJcvrH/OQ/BrAHAYpIjVX6fsgUoh9SE5Nnd3g" +
+ "zZ5U311/Jt21rX2reXWLDTZ/Plt2iTpC7o2wIXi1ZXpMuC6o8jl5NNK1ufiCI4QYZ8zRkXIHc+o2" +
+ "dz09LIeRrw6SiggEnXNekIZCX/GNh80mkAv64zdnUUYI0HBAe+mYJ+Nr1mrcgsto/JjUU7aG0HJw" +
+ "+mYzx3Gbozde2ufknoISciz5pzjP/aWwB0x5a9CZA/D50hrXtw0a0Z74AjpLgzVltLPpLeL6iG0q" +
+ "eT0iGQ45tex4C64YGHHmL7H5CevzIRfV6WbHr9aOqNxCD9C+CUGRTi4P7HgYpJAYcQYpUDlYDyTZ" +
+ "uEAOmsMCvAloH931YhIqh4pM4neZHlDC7ge0QXGq3/NLHebo/hoKeLx0j4W6vYfxgmqONk1Z7due" +
+ "evpJXmdZdgqUfrP4SJAw0cwobQOPhxgmZKfQ6vLuWksVK01CgzfuOkOo9dB+BxE22TtpuR0dZtWx" +
+ "5D1mSnijyQwYG81v3lFp1zqdJyCT3oUR+eWUtlMov3JgIyU0IgUjij0OEElhAMjJ+KcAgKEwiian" +
+ "dEBke53FPGUpTUCivh9BPQ6TeB4ItgkHv95D5ja/YbE5Kcso/Ah83Gd1SfgrmWZa+wPapwe4uj0T" +
+ "jpLP0z5aD7gqh2N4eknQHYyEYxifBLfE73Xh6/iQvh0EgZswbko0hjTQy+okSCPz/dRWAhP5wpqw" +
+ "140Z3KDUno9Mj1DVf4gJcEhAuAxueaRvE3g3ECbMUAsVZTVzNPYDHEzgiCIDpOcyoJLlCUYWcet4" +
+ "7ePfQZgnwEPNsoYMlyTqz+j5vpktwW0r+fzEMVLJS375MNcESaVLotl3VcK3PHTjsVVFJ3ImDNmM" +
+ "xZAMde2fScG8uc8ZcMpgfnzNJbcHJ2tm5zhDJDGicfN9dMfMjVUO1RR+3bf0eOIquh8+LnG2HusW" +
+ "sWYE+LoxjDBuDur0G2LibFPEDPZ4d2LsHxCzY+kya2SyDctcxxMbhDQmjhzXanEHsHH8Xxb+M/5d" +
+ "lqVPIKkHerSdSSUu9nMGRBMD0tkxGAww5uHB3dbnIY8H4jKEJt549/JdtanPlOc7z8dWrmousQIS" +
+ "QPL3dohW47oSBtCNlmbWOTkS4SZCy3G4kR8IhnaNmh5eqaUO9Tu3ljXXoe56jpfcnek/iH+H1vTx" +
+ "ToHonOg8Gwcx7QnNg24NQkJjgF94VHeqSTLUDqap8BMXW7Rgihk0fA15wQ+fmff999UT+MVilpVv" +
+ "9/P9iHQYfglcQJx1eTrPcf1s/YP0/8f1/u/caT99S5oXWNyhVBcMwDsM/jFSrOPBDwI70ki97A8P" +
+ "h7POfVftueN7/4bc3zV3EfGmj4EVKYLiCEiDYLHGYX9qm0SEAiRIEDuA8Z+YiYA/PUEkFF+MAKiR" +
+ "P2QpOQQdhjIkDIH1yFmsx7DTsealkpikVJonTCoxIp16sK8zzCRJJCfB+vkaptsMEMjbzVE6/9CC" +
+ "XslEEkDiZnPqb7xvvLWb6EBuGSpbCWJbOzPPIekhGTrDqCgCRGXg7wE/WCI+xZbbCVCIkySVhDU6" +
+ "iSHwoqKSnM9om4Z+VKwjShuINg52K8xiMgTwcy+gB5aaaOlIdh6ltZRzk3GM2E1j3QVv0JgtFBEi" +
+ "B9KFkiEEIztjqiVuhtcVgDgDMCQEiQclOBoAb8j0kNzmZqMgqIQiZyBxTqm6JIyIan6NinYhxYSG" +
+ "JyxBA7ymhR8re9Z0wbHbWDFwvUz+H2n2RjBgBMwyhQIayPV9Z14rzyRErRFjaGPLy67W6iyXl3Bi" +
+ "baZCCO67rXs83l5nOutKxBdZDJhhgR1o0apYxhmB4jBgRjEkIT4M9v1zp/I+fbCK8HnO575lkn/x" +
+ "DEhI1lUimGCeYmY5MEkeC/y8HN0fCoDIwZ9/3pzHcanVKpKQPfBNYgf8IpQ06r+VWJIT5W9+InZH" +
+ "GBcbENwEEToXgsIRM0+tLJYkbNix6sWTPLym4icYJ6NsCHrhCHEKRg49maIIwxhSFlsVLRgmJqBb" +
+ "AumFgMpAs0VWMksRvTYghmJ9oesSkwRgrCKDMOdW2onug6Y0rN142vIQBbkKICtRkQq6UsiWaIXf" +
+ "c4N2bAwue2bqKYCGpIiOjrJ9ILIqidEw1MsBF6lIgwsIUJQClSjJAxAJoD8OKwGYB+kzQbYCMTnC" +
+ "nptKOOJa5ZHsK0mYAYNjHHrhFUh+gdf22ft4lhwoht/4iB7pvf74yUstSpWW2BpaTEzMUNDT3+Xx" +
+ "tPZn5va3v7uWsyKsGANWqXAuyIX15bBzAkZcp8ThuDWjZkp7muszHKImsbggb0fmTRp3aoY0BZww" +
+ "qBtlHwvDMYcNnFUOcLBBiqRETh5a8C65MWUeQ3hMEGJA4axRgXCw3LeXMtTZrYS7gOPxqwk/9yho" +
+ "kEN2xaGzpqw0Sx7DP2Rx5OAjGC2nhkCp8eZ7Pcl6KjB7Y1OtCDUXvxr/fIo5Y61MRMo4QBdOORqc" +
+ "H7TSFEUZGRhWkgiiS2Vg2yEsAtkkoqEBBMU6tPGHlxJyOznTetzfbDkQQst0/e/824wA3uKb+eks" +
+ "8KhidRlsSMJBJEDAGfzk7/5Zwkpr3THH5M4PBEx5n17Ub0qggdJM6LfZGplTeD7d7M4RbsaW+zIh" +
+ "bbHrVtBWQYhgTBtzG8s+zmYYfbLM0FtOXg3zdMTnLhLwVII2G07inYX08zDn46f98SfttMDc7tdq" +
+ "tR1vJxHXPFvm56Di3fbb7CB5oO2a2Qkju78J+mXaTrL884tikdO2h9ScaToWOhUMzwO0W+zHSZ3r" +
+ "gy5mzHTPHYxsYRs8BGEQ+z4iyuKoWDUuxuuUwlwHdjD1w7IqRDSnYXEtsIFvacd43TY41gWmzczS" +
+ "imfZnvZw6hxrbbgziJaIZmveTeQXOoZsrON81oli52q8qR91ydprp136HHBswDP06BnoTlbpY3Bp" +
+ "hxKurWoC0sheZ0mG1NnXPK+WlJUMluUhjBkEb5UN5eLeEtxZkYYDTjx3XXn15raUWGBjKdQ2iYzq" +
+ "u80wb8DmFyWsdxFmhLGIyYgd3WU0Pd8HW9zvOpFDiJdh5QzUuMvN1MXW8Xc3O0TnOCSjDNYZY0OO" +
+ "1l7JZqnMMugzQwuoDOzTRBiDjHcGRGNUQQ2DOnKqECwRXKd7FCkOgWFiBxOkpCHZANAzRcxiCQYb" +
+ "TJBF6CLIoRQDtP4fLn9Peg4WBtZDpZ5UAwYLAEQURCfyfn6S47noxNAXMzYSQFhCCyECABAmB0Kz" +
+ "sw98wXf6rwgt4pBiQBukIhpoDiPT1PZtXMNxjvUQ4/qymZQ5rMw2BooMJn8SQkzvzpPgv1xtKu2M" +
+ "bMMfIRhYQNysAjqwTTY7i2ZqmOtw3gIc0oq6OqHWU39P0my8MNYbESokIP1kAOhFL2GQCw5GcPsj" +
+ "5BJdoBvGEeRzM8J2Jyx6nk5l6oJCrEGKvhCHMTXB1hYG1fP3a1n2ZA7vGrcbs+3KApFTBlZS2mMh" +
+ "JDECQxtcC34jSXUwOnsNeEHhiI8GWOiMInnEM6+bYdZ4z4ezEWCLEioyDEjAFmk+g8b2NRvRdMbj" +
+ "ZSNjM2KKmb6Ha6hS2zWlBqPh9L2eW2vVXy+veMsGVCKUsUCSoPWmmGMsjWUJLl8YlplnIPSBobnz" +
+ "ppHclkdYC2eWr5gqG0KcDtgoe2Bm1EVjFJ0rBCCqWhOGR00mSNBFDeJuA8I+jSGykN9il6Shmj1k" +
+ "D88BYgyLCe6lM1XjJDIY5DwVNmny26pmRqq5hxN0770E37hPulwMJkrjLS3TImIOLamTjAFEyWKm" +
+ "xQFKMhxOvYsr5MAgQ3/OJ4QOYm5WQP0hXg5AA5xQYME7fFCoBIJEOPM32CAfqQ2oO5cPfF8JERhB" +
+ "SU0J+SCWAXFy9RupRaY/bh9QdwQP3sZJHx6EPIQ+J8mOUvp8vfAfZP4sJgRGLbKMUgxAKRkKrCEi" +
+ "viWV+jrJIglYLIRqj0ko6QxcWWHtEoXyCSQbiZMgAicn6GG+0YcTCSFz0sVIOk4Sfnequ1CyymVQ" +
+ "LQ3mt2q9FRkJa3zVEkFgJjEzOjuygElBVCB2m2ZUnPzGrmfRqfDs8KSCiCMVjGD5EPW8dBEnA/dZ" +
+ "26RHQB3mI9AGQ0dG8Yez3OW9Uo2lBBthKkbYWuYUzxyEODR/OB+Mw09HWNPsDiBdsvpDYtitRVJQ" +
+ "bURSAxT1TiElh9RIO5SqWwOMh79GtpJXuRhkfidxAn0IIP0sULRYwRhbbbZVw8w3Dx69lZ8oQtn+" +
+ "wP+h0JOY/eeT4y/Y+mynVjc5IYJQb0t3QkHIPqgQ4JxJmb5W/6+t16TV6Q+by3Xlmv0stEbJZYrP" +
+ "3Vpoa9J+LBhGBGAPEoVOegvTxtQgwZRI2goEUkkG2VKwlJ0nh0HWKmRzfwpOI/YkTF/JwVzgiceK" +
+ "QIjIE8TnxOv173TUwNt4te2B1fU15wGEE6oPpez8o+JryMT3HvDXaF3ii9ywJEDh29LbRHw35sTZ" +
+ "HTbm0Dz3w6O+XOshot1XKs5Lyq9XgmgGRMLOl2h0wOL4dK8nS97r4YhKE+/uuOPkGz7ENQzrDqaK" +
+ "eCCxggisgKqJQkgGoosJGYdV6vjqW6etE4h8zj2jpuIA8yMkgoSDUix+cZAYrLAfWAwz41REqpH0" +
+ "nyD7fFGk2pLUWmZq0jVTaV87gpTimFoMk6CG0MKU9N2JZqGZMCzUFNQKXCFie2Bk6NFkN2iahqd0" +
+ "TUL0PoBd0Z290I/cUoEZ4MYRRbKLTp6ZNhloaSFsqo0paokUEGQjIQIiRYC/pNEC6IqiF8Dkeyqn" +
+ "JJo/j+AEzeusxpCBHZbt3Z3nEOiGpTDhSLd02YNlpvN3JN2biuIUTWVJkqlpZm2SadzIymtOoIwm" +
+ "9Cm4MSGFJl3fXvWwqG8TZUw4NAZGMJrJOfufKAya+i0Gw7zE2PDQVPZippYfkBJIblusI7LkQF4w" +
+ "TieqM1Q391XtVi1ECRGwuacU3RoM+hiBIFBRIZW/vXKsjEOMVmhRmGZaE7y9THsnwzG4vjKAkhGc" +
+ "wJ1qQdFgniU0EqNFctIja5vRKLqjOiKgxZIk7lAoBg22zgmZRQssDPaAyL90EObLBA6eghCMQhdt" +
+ "CL5/ses39Q/Kjqia4HvV7wOFvEaShymnHiMeJQ0SYBGE8aFnxalICkMPOw0qOUl3Nwgckkj8w0L4" +
+ "9fVrVNZNOPnwdJycD9FNJ9886azUp5tqGY+EAYeKTfvgnWyMDoYgZGLDNSmJnCqaAMIBkGdDc8rR" +
+ "RIpCpUktoRdFzBodMKjG1K865pNFr0q+DTbT9cKuI6noLmhbcIUQFHS5v377BVJTsRM38/k7bjVQ" +
+ "/QsGFAWOwy4omnhwaQ4dir9UBWLBQtxIJqOc0kd+1gLNFJRamnepDQhCb0D22mGERkybwyhxbkvG" +
+ "DfXrYw0hu4GOIYTDa3IR130b1DVq4FlBjTdyZZILa5cMBJorNMsfJKzYbIZibbkDp9eD+qcSCJ+Z" +
+ "Aw6J6JiTwaKiMsCRrPJo/VKomqUUaNX77+KQwCQBk8d+WuyGzDeB+XezzxcuJGLIhkMpMD6P173X" +
+ "LtobHIhvI8zl/jzAYzfP15Vtfno0bRSr3OiMZIyCc76lEhkyY6kJdFFExO7MSLFNET9zDMoTSfEm" +
+ "FECcF1Y5N4ToR0aUA3GSzFkiICKKM2wagnNB58ypLSPqzEaq0TxVGQloCZoMHKnM4RsYCB3sjADF" +
+ "0ulOqQx3OhD3kXkllMGDo+iI0e2gNQihIWnefq7k8HyQBTwO6HqOTDBbhLDMeBmE3d2ry1uaxUlV" +
+ "9WZLWNc18Mua2SNpqTx2umteedVqW9zIWW4rAboajE0SBhAcQLS6xZdoLE5myiDDRCnAer5IeqVC" +
+ "p4fZ8tnsnIL0sMgb0WgFSV2D9yOEDOg9ScQ8SeBT9Fu13qH0Ia/TilDH0r7/kCRPayBFqjiF41Pn" +
+ "B+IRYJBzdlB68ANn839DLohhGQB64qMgHpYhQyLpQVEYEQUCwmtEiprwfikV8whevoRXFAgbsEuM" +
+ "IAGJosjS1IzJmtC2QVIJ85D3MhplhRsD2JLlKgZlCBGRTx7OIFoaJDWV1p6ZY2MA3mTkVuTCLvkY" +
+ "B9GQuA5JGEEkAIzNyD7XtQedjp3G16IAZoIFHukAm/wpuNsrbW9+RESIe+yorMlloVIl62QMxK0l" +
+ "JIsGBZaSASHuIqUkoOtNsqdiQ01oDA3qvbA9AFEWBFXviyRgWqSxkWs2irRtSWyo4XBSwbCYjsF0" +
+ "JyEDqA876sc4VAoO4NNd5wAlkHoPthseqcSMzdXvnnuMNy9LCQ76CTonH2SJtAO7mFUwWlkEafWW" +
+ "UJgaipGBIwwcBTZozNJTWvxlhY6P1jTHN1r7qs+a63NG80pJo1FGpCgpWmW9G07U7LmClLJRMtIH" +
+ "+XRZByw0WARSKtIlpEEa++lAsGIXNYJSOdY0GZbMFERKblrWECLFCWULJbSgFSpXyNoOytD3YL90" +
+ "xYSQhlD1QLJLQI0He9BzCEnVUSqicw+8My4R9hISYkJGYIxj8ruAhMajQwXdcJGBSBFRYiEzLDQs" +
+ "CajBMxmCr9tr+pNttLXxe3r5N7djRszWjJLEZs1mapMmmTJTQTNpSqUZsNU0JRlqNljWTbV+p7df" +
+ "Lo0rUkVjdV+CKMDKORHjOxLhIwk9G21jFEYFD4XjWjw8wvyPogFPIeTDwiBloHASYHMk8xALgXwl" +
+ "ATRqLTEQYWQsVkWQUKaMBwo7AQKQfAF3fSVyBBLobqUc9N30Yhd9lPGGxI9LQNomLwZp5ZZsMZkl" +
+ "oF2Byvel2w26lwkZCYQKHFs8KDgeFO2+29nFIKMOG7yWYijLbKDKNtLaksQtZVRtZBGNkVAxCiCA" +
+ "Y0LYLJWyyolpYoiIlGrAkS1LLY5k3YQxlKvO3TdNkNSU2Rdd21cyEIcUog9BsnPOQYJDHgyjFjMY" +
+ "rbgvBfJuwtEhGMMokttuSiYYRmQzSrobTNZGFRBRJ0D9I/mJERaCCLCgGiqRrIBlFPnSl5lPE51v" +
+ "mPyjjESFnwAxWlkO96k1MjkQjxldSypErtlBcLC2xJa5YIMOc9hTxTkPSHujC48AnAicrbndNoPO" +
+ "N74pxoN1p5k0VDQyShtPkmhEPSBIBwWmSBAhFI4ntAwUbinCB4hQIFQWEEWCWrvE3qfzQrTTT7si" +
+ "6zQ8MvTyensgBuMEix6adydCOBCBUjFYG+R5YCfYgcfe3KBA528A6ViECYJgPJNB3nSTyDyPKUoB" +
+ "/mQIKxFDYbNYIYrQNbnFO2rWmvkt5vFGebcxXGlIkCiBwVLS2QolREpXmBd2Q8XDpAVtaSkE0BTO" +
+ "nujaCkO9awitnCKKcMnFFHh6fqiPxztdZntuRCeDzyIgwh826nhMzIM2TOwEXW01STLWw5saZe6L" +
+ "ZJoHfoIya3HY79edGjjYfToLT9W+yIpw8X2hhlKhzNjppSbn3t5mBXnyGl+qT7uQbI5+TV6rtb5z" +
+ "y+41+l5LWFxPpRlQGUYQndmJEQkgvWI4R/1s40rG2dyJDQtbruUVR5sPluFVcb5o5DQrT35OfHg6" +
+ "nXsdDhJ4Nkg6D223DHsUoizm1yj4XOdaoIMlVhMBJZJmCIHqgC0gfgz7LGB9HflZG54HCcBh4375" +
+ "6X1dGN+X5axnNu8vqiV7DyNFDXakMyESZcSBwet+6o/TaDQ2yz52GvPcN8lqBxN23CHsR/XQBTJC" +
+ "lBxVhYJyjcQgQvEU1rk+6HSk9vKX+aSBPeAzRGEsBBisD2+XwrWjbRJaEliHqYvlo00yzvSnv9dM" +
+ "IE4khSVKE0W3I2lkgwSAHIhNIEKQQELu+sjBqOm7Ur2wecZHEVHbQYRG+frxWHNZz8VZk4Em5sHZ" +
+ "45CsKUcCifEbXdlIxssZqYYyRUVA+UgcJuAeJwptCkVnJypDkksFFCXJaUuMU2A9AwjZg0nU3GQF" +
+ "qrx3zaKJS3bl733s0xg0apuNuDStMwxlcQVMQQKVQSCZvRLTcU76R4xLMmc45p69aBkD9poNHIAd" +
+ "IFnQkWRDo32AsplDEwLMsMJsGweqY8JPrmunefNpeK8/dLFIqiYhNYz0QzOmhJGEB4LqASPQy9S8" +
+ "obyytQSt66RgQTZZrWZKxiBqQEicBaQPIO6uPfxPFVgzwxzWUbAkltjaNVbTLUj8W+oEtzaWw8tn" +
+ "JhMw+KeonmDEPs9ppd82wYnDsFIVXJTYejCLMRdxe17QzSmWWQ5F4rbErEQhMxuQb6n4lrW+BF4V" +
+ "MbVfZ4moMOjGHVTmNx+DkrbHWs9JZwe2dbvDNDJnT1xJDMtVDIDNVn28eMDhnCKVCs4SsDGI3JRC" +
+ "4FRQycOmGmzVtDCswMNYHQutmo1uWyqAiLp4YmEIKcdLMpQRYzDRcy/Gryi4zHhmO2DrMlwtiFxs" +
+ "y2URYJEW2gl9WQpkJcLLPWevecJ17XXby7blWRRB4c6cgYhEYsM8wsNyABYwJtUgZTpNybGcdonJ" +
+ "jJYb3nicBcbBxDZzEMgiSIY4IkvGEhqJZLjBsFwzJlyJGR+DaLlt2SkuN17TCLhcW8YTBMwUziQJ" +
+ "n52sYOp21W0RM8UC+fKzk0bnoqBHWMxnAW7wCKc/x7rcjpmWhpRANpXlDKoBjEXS35bNSwzddkdA" +
+ "OajcSPD5WSQxnM63z99hzqciJVGxghWs2lipUVyOSjj0zMZ8aVDnmx9pb2tWoKtfFa3u2xrTKS1N" +
+ "7OFeumgtBKKaR+2UJzieUMYBjAIR0WTWmbctjckr7N3VPOru7XMVNk3dt2WIqK02ZudmLFCQkCqp" +
+ "qCyBjGVEdTfF1r7+h+B4O7cou29BYbMh0BFODClliYY5AfJs4+D71Yp7UjPhZjgi333MsPyptUte" +
+ "pFqLJSVa3K525vVziUCCba1HiWF6EI0alvjIt9W7XktfUWvmlum4Kk1aPtoT6dBkB9UaFZ5QZbHG" +
+ "W9Hx/keXtc/nnahU1Y7RoJIXYWFhEDWKe07iby+65oodgnCkf5NWkMTu19eoiz4tB2FkEbAkZFkC" +
+ "QJE2Av9uxj+i4HbYr0Tvi1I5100j8WCciL7h7fGgQTpfTgkJBFPsDsIMZBj5Wy+oD9j+QeOzkqpU" +
+ "q/oD+P02H4E8UHwsrFH7aSsGVsBMw62mEXoSkQ84lgDk6QPTQSKJ6IDuMet75Q5MuoXGTnYascmB" +
+ "kZYOrLA4yQwFTEheZ+Y+BIKiIshoD3MOAx7LfBLUJvRj7KCQhCEoyU2M7LULDIge6lGgjgY1GgVP" +
+ "1KiERIjIAqighIyEC+Xs59Werg1dzsxTVbdmPUHCsMCzELDJzLSojrMVCiDFw8Wmp7p8Vfz5LJrI" +
+ "SQcTIJk0em8ShhFjDJtzeGIl0lZ35N7yVChV+qBCJAjIDCMsy22FjGaitTTZRNUXvy4bk3m7YZ2P" +
+ "WRoBNMYUgOEQMeLhWFF1FeiKoHKwXDHI4GF4EzoogSYlFYVPFwyzgyUiM/HtTQzSwY3/935P/pVS" +
+ "I5ztPxjuSv4UbQOH7cbKdMD1cq9uVWjVUZovZM7cZLxSrw2eWrDGsDgVWAPhYSdXl3xfH0oaTwfb" +
+ "21zqsFhC8NIHdIQSGZveMwM7oSy4ZzP7nD3WnjXGmq73mP93ldP8PvgOpMwbfV1RvR+V/DOnF9rK" +
+ "v9hdyRThQkN3QmOE"
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/regexp_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/regexp_test.go
new file mode 100644
index 0000000..3ce9f3a
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/regexp_test.go
@@ -0,0 +1,59 @@
+// Copyright 2013 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+import (
+ "math/rand"
+ "regexp"
+ "testing"
+)
+
+// benchmark based on regexp/exec_test.go
+
+var regexpText []byte
+
+func makeRegexpText(n int) []byte {
+ rand.Seed(0) // For reproducibility.
+ if len(regexpText) >= n {
+ return regexpText[:n]
+ }
+ regexpText = make([]byte, n)
+ for i := range regexpText {
+ if rand.Intn(30) == 0 {
+ regexpText[i] = '\n'
+ } else {
+ regexpText[i] = byte(rand.Intn(0x7E+1-0x20) + 0x20)
+ }
+ }
+ return regexpText
+}
+
+func benchmark(b *testing.B, re string, n int) {
+ r := regexp.MustCompile(re)
+ t := makeRegexpText(n)
+ b.ResetTimer()
+ b.SetBytes(int64(n))
+ for i := 0; i < b.N; i++ {
+ if r.Match(t) {
+ b.Fatal("match!")
+ }
+ }
+}
+
+const (
+ easy0 = "ABCDEFGHIJKLMNOPQRSTUVWXYZ$"
+ easy1 = "A[AB]B[BC]C[CD]D[DE]E[EF]F[FG]G[GH]H[HI]I[IJ]J$"
+ medium = "[XYZ]ABCDEFGHIJKLMNOPQRSTUVWXYZ$"
+ hard = "[ -~]*ABCDEFGHIJKLMNOPQRSTUVWXYZ$"
+)
+
+func BenchmarkRegexpMatchEasy0_32(b *testing.B) { benchmark(b, easy0, 32<<0) }
+func BenchmarkRegexpMatchEasy0_1K(b *testing.B) { benchmark(b, easy0, 1<<10) }
+func BenchmarkRegexpMatchEasy1_32(b *testing.B) { benchmark(b, easy1, 32<<0) }
+func BenchmarkRegexpMatchEasy1_1K(b *testing.B) { benchmark(b, easy1, 1<<10) }
+func BenchmarkRegexpMatchMedium_32(b *testing.B) { benchmark(b, medium, 1<<0) }
+func BenchmarkRegexpMatchMedium_1K(b *testing.B) { benchmark(b, medium, 1<<10) }
+func BenchmarkRegexpMatchHard_32(b *testing.B) { benchmark(b, hard, 32<<0) }
+func BenchmarkRegexpMatchHard_1K(b *testing.B) { benchmark(b, hard, 1<<10) }
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go
new file mode 100644
index 0000000..6b6c1e5
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/revcomp_test.go
@@ -0,0 +1,85 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests array indexing
+// and array bounds elimination performance.
+
+package go1
+
+import (
+ "bufio"
+ "bytes"
+ "io/ioutil"
+ "testing"
+)
+
+var revCompTable = [256]uint8{
+ 'A': 'T', 'a': 'T',
+ 'C': 'G', 'c': 'G',
+ 'G': 'C', 'g': 'C',
+ 'T': 'A', 't': 'A',
+ 'U': 'A', 'u': 'A',
+ 'M': 'K', 'm': 'K',
+ 'R': 'Y', 'r': 'Y',
+ 'W': 'W', 'w': 'W',
+ 'S': 'S', 's': 'S',
+ 'Y': 'R', 'y': 'R',
+ 'K': 'M', 'k': 'M',
+ 'V': 'B', 'v': 'B',
+ 'H': 'D', 'h': 'D',
+ 'D': 'H', 'd': 'H',
+ 'B': 'V', 'b': 'V',
+ 'N': 'N', 'n': 'N',
+}
+
+func revcomp(data []byte) {
+ in := bufio.NewReader(bytes.NewBuffer(data))
+ out := ioutil.Discard
+ buf := make([]byte, 1024*1024)
+ line, err := in.ReadSlice('\n')
+ for err == nil {
+ out.Write(line)
+
+ // Accumulate reversed complement in buf[w:]
+ nchar := 0
+ w := len(buf)
+ for {
+ line, err = in.ReadSlice('\n')
+ if err != nil || line[0] == '>' {
+ break
+ }
+ line = line[0 : len(line)-1]
+ nchar += len(line)
+ if len(line)+nchar/60+128 >= w {
+ nbuf := make([]byte, len(buf)*5)
+ copy(nbuf[len(nbuf)-len(buf):], buf)
+ w += len(nbuf) - len(buf)
+ buf = nbuf
+ }
+
+ // This loop is the bottleneck.
+ for _, c := range line {
+ w--
+ buf[w] = revCompTable[c]
+ }
+ }
+
+ // Copy down to beginning of buffer, inserting newlines.
+ // The loop left room for the newlines and 128 bytes of padding.
+ i := 0
+ for j := w; j < len(buf); j += 60 {
+ n := copy(buf[i:i+60], buf[j:])
+ buf[i+n] = '\n'
+ i += n + 1
+ }
+ out.Write(buf[0:i])
+ }
+}
+
+func BenchmarkRevcomp(b *testing.B) {
+ b.SetBytes(int64(len(fastabytes)))
+ for i := 0; i < b.N; i++ {
+ revcomp(fastabytes)
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/template_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/template_test.go
new file mode 100644
index 0000000..db4839a
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/template_test.go
@@ -0,0 +1,76 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests text/template throughput,
+// converting a large data structure with a simple template.
+
+package go1
+
+import (
+ "bytes"
+ "io/ioutil"
+ "strings"
+ "testing"
+ "text/template"
+)
+
+// After removing \t and \n this generates identical output to
+// json.Marshal, making it easy to test for correctness.
+const tmplText = `
+{
+ "tree":{{template "node" .Tree}},
+ "username":"{{.Username}}"
+}
+{{define "node"}}
+{
+ "name":"{{.Name}}",
+ "kids":[
+ {{range $i, $k := .Kids}}
+ {{if $i}}
+ ,
+ {{end}}
+ {{template "node" $k}}
+ {{end}}
+ ],
+ "cl_weight":{{.CLWeight}},
+ "touches":{{.Touches}},
+ "min_t":{{.MinT}},
+ "max_t":{{.MaxT}},
+ "mean_t":{{.MeanT}}
+}
+{{end}}
+`
+
+func stripTabNL(r rune) rune {
+ if r == '\t' || r == '\n' {
+ return -1
+ }
+ return r
+}
+
+var tmpl = template.Must(template.New("main").Parse(strings.Map(stripTabNL, tmplText)))
+
+func init() {
+ var buf bytes.Buffer
+ if err := tmpl.Execute(&buf, &jsondata); err != nil {
+ panic(err)
+ }
+ if !bytes.Equal(buf.Bytes(), jsonbytes) {
+ println(buf.Len(), len(jsonbytes))
+ panic("wrong output")
+ }
+}
+
+func tmplexec() {
+ if err := tmpl.Execute(ioutil.Discard, &jsondata); err != nil {
+ panic(err)
+ }
+}
+
+func BenchmarkTemplate(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ tmplexec()
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/time_test.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/time_test.go
new file mode 100644
index 0000000..4687de3
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/go1/time_test.go
@@ -0,0 +1,25 @@
+// Copyright 2013 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+// benchmark based on time/time_test.go
+
+import (
+ "testing"
+ "time"
+)
+
+func BenchmarkTimeParse(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ time.Parse(time.ANSIC, "Mon Jan 2 15:04:05 2006")
+ }
+}
+
+func BenchmarkTimeFormat(b *testing.B) {
+ t := time.Unix(1265346057, 0)
+ for i := 0; i < b.N; i++ {
+ t.Format("Mon Jan 2 15:04:05 2006")
+ }
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go
new file mode 100644
index 0000000..071a4e0
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.go
@@ -0,0 +1,129 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ *
+ * contributed by The Go Authors.
+ * based on C program by Kevin Carson
+ */
+
+package main
+
+import (
+ "flag"
+ "fmt"
+)
+
+var n = flag.Int("n", 15, "depth")
+
+type Node struct {
+ item int
+ left, right *Node
+}
+
+type Arena struct {
+ head *Node
+}
+
+var arena Arena
+
+func (n *Node) free() {
+ if n.left != nil {
+ n.left.free()
+ }
+ if n.right != nil {
+ n.right.free()
+ }
+ n.left = arena.head
+ arena.head = n
+}
+
+func (a *Arena) New(item int, left, right *Node) *Node {
+ if a.head == nil {
+ nodes := make([]Node, 3<<uint(*n))
+ for i := 0; i < len(nodes)-1; i++ {
+ nodes[i].left = &nodes[i+1]
+ }
+ a.head = &nodes[0]
+ }
+ n := a.head
+ a.head = a.head.left
+ n.item = item
+ n.left = left
+ n.right = right
+ return n
+}
+
+func bottomUpTree(item, depth int) *Node {
+ if depth <= 0 {
+ return arena.New(item, nil, nil)
+ }
+ return arena.New(item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1))
+}
+
+func (n *Node) itemCheck() int {
+ if n.left == nil {
+ return n.item
+ }
+ return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func main() {
+ flag.Parse()
+
+ maxDepth := *n
+ if minDepth+2 > *n {
+ maxDepth = minDepth + 2
+ }
+ stretchDepth := maxDepth + 1
+
+ check := bottomUpTree(0, stretchDepth).itemCheck()
+ fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+ longLivedTree := bottomUpTree(0, maxDepth)
+
+ for depth := minDepth; depth <= maxDepth; depth += 2 {
+ iterations := 1 << uint(maxDepth-depth+minDepth)
+ check = 0
+
+ for i := 1; i <= iterations; i++ {
+ t := bottomUpTree(i, depth)
+ check += t.itemCheck()
+ t.free()
+ t = bottomUpTree(-i, depth)
+ check += t.itemCheck()
+ t.free()
+ }
+ fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+ }
+ fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt
new file mode 100644
index 0000000..f8286dd
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree-freelist.txt
@@ -0,0 +1,8 @@
+stretch tree of depth 16 check: -1
+65536 trees of depth 4 check: -65536
+16384 trees of depth 6 check: -16384
+4096 trees of depth 8 check: -4096
+1024 trees of depth 10 check: -1024
+256 trees of depth 12 check: -256
+64 trees of depth 14 check: -64
+long lived tree of depth 15 check: -1
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c
new file mode 100644
index 0000000..9c35ac5
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.c
@@ -0,0 +1,164 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Shootout Benchmarks
+ http://shootout.alioth.debian.org/
+
+ contributed by Kevin Carson
+ compilation:
+ gcc -O3 -fomit-frame-pointer -funroll-loops -static binary-trees.c -lm
+ icc -O3 -ip -unroll -static binary-trees.c -lm
+*/
+
+#include <math.h>
+#include <stdio.h>
+#include <stdlib.h>
+
+
+typedef struct tn {
+ struct tn* left;
+ struct tn* right;
+ long item;
+} treeNode;
+
+
+treeNode* NewTreeNode(treeNode* left, treeNode* right, long item)
+{
+ treeNode* new;
+
+ new = (treeNode*)malloc(sizeof(treeNode));
+
+ new->left = left;
+ new->right = right;
+ new->item = item;
+
+ return new;
+} /* NewTreeNode() */
+
+
+long ItemCheck(treeNode* tree)
+{
+ if (tree->left == NULL)
+ return tree->item;
+ else
+ return tree->item + ItemCheck(tree->left) - ItemCheck(tree->right);
+} /* ItemCheck() */
+
+
+treeNode* BottomUpTree(long item, unsigned depth)
+{
+ if (depth > 0)
+ return NewTreeNode
+ (
+ BottomUpTree(2 * item - 1, depth - 1),
+ BottomUpTree(2 * item, depth - 1),
+ item
+ );
+ else
+ return NewTreeNode(NULL, NULL, item);
+} /* BottomUpTree() */
+
+
+void DeleteTree(treeNode* tree)
+{
+ if (tree->left != NULL)
+ {
+ DeleteTree(tree->left);
+ DeleteTree(tree->right);
+ }
+
+ free(tree);
+} /* DeleteTree() */
+
+
+int main(int argc, char* argv[])
+{
+ unsigned N, depth, minDepth, maxDepth, stretchDepth;
+ treeNode *stretchTree, *longLivedTree, *tempTree;
+
+ N = atol(argv[1]);
+
+ minDepth = 4;
+
+ if ((minDepth + 2) > N)
+ maxDepth = minDepth + 2;
+ else
+ maxDepth = N;
+
+ stretchDepth = maxDepth + 1;
+
+ stretchTree = BottomUpTree(0, stretchDepth);
+ printf
+ (
+ "stretch tree of depth %u\t check: %li\n",
+ stretchDepth,
+ ItemCheck(stretchTree)
+ );
+
+ DeleteTree(stretchTree);
+
+ longLivedTree = BottomUpTree(0, maxDepth);
+
+ for (depth = minDepth; depth <= maxDepth; depth += 2)
+ {
+ long i, iterations, check;
+
+ iterations = pow(2, maxDepth - depth + minDepth);
+
+ check = 0;
+
+ for (i = 1; i <= iterations; i++)
+ {
+ tempTree = BottomUpTree(i, depth);
+ check += ItemCheck(tempTree);
+ DeleteTree(tempTree);
+
+ tempTree = BottomUpTree(-i, depth);
+ check += ItemCheck(tempTree);
+ DeleteTree(tempTree);
+ } /* for(i = 1...) */
+
+ printf
+ (
+ "%li\t trees of depth %u\t check: %li\n",
+ iterations * 2,
+ depth,
+ check
+ );
+ } /* for(depth = minDepth...) */
+
+ printf
+ (
+ "long lived tree of depth %u\t check: %li\n",
+ maxDepth,
+ ItemCheck(longLivedTree)
+ );
+
+ return 0;
+} /* main() */
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go
new file mode 100644
index 0000000..9f867d1
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.go
@@ -0,0 +1,92 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ *
+ * contributed by The Go Authors.
+ * based on C program by Kevin Carson
+ */
+
+package main
+
+import (
+ "flag"
+ "fmt"
+)
+
+var n = flag.Int("n", 15, "depth")
+
+type Node struct {
+ item int
+ left, right *Node
+}
+
+func bottomUpTree(item, depth int) *Node {
+ if depth <= 0 {
+ return &Node{item: item}
+ }
+ return &Node{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
+}
+
+func (n *Node) itemCheck() int {
+ if n.left == nil {
+ return n.item
+ }
+ return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func main() {
+ flag.Parse()
+
+ maxDepth := *n
+ if minDepth+2 > *n {
+ maxDepth = minDepth + 2
+ }
+ stretchDepth := maxDepth + 1
+
+ check := bottomUpTree(0, stretchDepth).itemCheck()
+ fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+ longLivedTree := bottomUpTree(0, maxDepth)
+
+ for depth := minDepth; depth <= maxDepth; depth += 2 {
+ iterations := 1 << uint(maxDepth-depth+minDepth)
+ check = 0
+
+ for i := 1; i <= iterations; i++ {
+ check += bottomUpTree(i, depth).itemCheck()
+ check += bottomUpTree(-i, depth).itemCheck()
+ }
+ fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+ }
+ fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt
new file mode 100644
index 0000000..f8286dd
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/binary-tree.txt
@@ -0,0 +1,8 @@
+stretch tree of depth 16 check: -1
+65536 trees of depth 4 check: -65536
+16384 trees of depth 6 check: -16384
+4096 trees of depth 8 check: -4096
+1024 trees of depth 10 check: -1024
+256 trees of depth 12 check: -256
+64 trees of depth 14 check: -64
+long lived tree of depth 15 check: -1
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c
new file mode 100644
index 0000000..ed78c31
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.c
@@ -0,0 +1,330 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Benchmarks Game
+ http://shootout.alioth.debian.org/
+
+ contributed by Michael Barker
+ based on a Java contribution by Luzius Meisser
+
+ convert to C by dualamd
+*/
+
+#include <stdlib.h>
+#include <stdio.h>
+#include <pthread.h>
+
+
+enum Colour
+{
+ blue = 0,
+ red = 1,
+ yellow = 2,
+ Invalid = 3
+};
+
+const char* ColourName[] = {"blue", "red", "yellow"};
+const int STACK_SIZE = 32*1024;
+
+typedef unsigned int BOOL;
+const BOOL TRUE = 1;
+const BOOL FALSE = 0;
+
+int CreatureID = 0;
+
+
+enum Colour doCompliment(enum Colour c1, enum Colour c2)
+{
+ switch (c1)
+ {
+ case blue:
+ switch (c2)
+ {
+ case blue:
+ return blue;
+ case red:
+ return yellow;
+ case yellow:
+ return red;
+ default:
+ goto errlb;
+ }
+ case red:
+ switch (c2)
+ {
+ case blue:
+ return yellow;
+ case red:
+ return red;
+ case yellow:
+ return blue;
+ default:
+ goto errlb;
+ }
+ case yellow:
+ switch (c2)
+ {
+ case blue:
+ return red;
+ case red:
+ return blue;
+ case yellow:
+ return yellow;
+ default:
+ goto errlb;
+ }
+ default:
+ break;
+ }
+
+errlb:
+ printf("Invalid colour\n");
+ exit( 1 );
+}
+
+/* convert integer to number string: 1234 -> "one two three four" */
+char* formatNumber(int n, char* outbuf)
+{
+ int ochar = 0, ichar = 0;
+ int i;
+ char tmp[64];
+
+ const char* NUMBERS[] =
+ {
+ "zero", "one", "two", "three", "four", "five",
+ "six", "seven", "eight", "nine"
+ };
+
+ ichar = sprintf(tmp, "%d", n);
+
+ for (i = 0; i < ichar; i++)
+ ochar += sprintf( outbuf + ochar, " %s", NUMBERS[ tmp[i] - '0' ] );
+
+ return outbuf;
+}
+
+
+struct MeetingPlace
+{
+ pthread_mutex_t mutex;
+ int meetingsLeft;
+ struct Creature* firstCreature;
+};
+
+struct Creature
+{
+ pthread_t ht;
+ pthread_attr_t stack_att;
+
+ struct MeetingPlace* place;
+ int count;
+ int sameCount;
+
+ enum Colour colour;
+ int id;
+
+ BOOL two_met;
+ BOOL sameid;
+};
+
+
+void MeetingPlace_Init(struct MeetingPlace* m, int meetings )
+{
+ pthread_mutex_init( &m->mutex, 0 );
+ m->meetingsLeft = meetings;
+ m->firstCreature = 0;
+}
+
+
+BOOL Meet( struct Creature* cr)
+{
+ BOOL retval = TRUE;
+
+ struct MeetingPlace* mp = cr->place;
+ pthread_mutex_lock( &(mp->mutex) );
+
+ if ( mp->meetingsLeft > 0 )
+ {
+ if ( mp->firstCreature == 0 )
+ {
+ cr->two_met = FALSE;
+ mp->firstCreature = cr;
+ }
+ else
+ {
+ struct Creature* first;
+ enum Colour newColour;
+
+ first = mp->firstCreature;
+ newColour = doCompliment( cr->colour, first->colour );
+
+ cr->sameid = cr->id == first->id;
+ cr->colour = newColour;
+ cr->two_met = TRUE;
+
+ first->sameid = cr->sameid;
+ first->colour = newColour;
+ first->two_met = TRUE;
+
+ mp->firstCreature = 0;
+ mp->meetingsLeft--;
+ }
+ }
+ else
+ retval = FALSE;
+
+ pthread_mutex_unlock( &(mp->mutex) );
+ return retval;
+}
+
+
+void* CreatureThreadRun(void* param)
+{
+ struct Creature* cr = (struct Creature*)param;
+
+ while (TRUE)
+ {
+ if ( Meet(cr) )
+ {
+ while (cr->two_met == FALSE)
+ sched_yield();
+
+ if (cr->sameid)
+ cr->sameCount++;
+ cr->count++;
+ }
+ else
+ break;
+ }
+
+ return 0;
+}
+
+void Creature_Init( struct Creature *cr, struct MeetingPlace* place, enum Colour colour )
+{
+ cr->place = place;
+ cr->count = cr->sameCount = 0;
+
+ cr->id = ++CreatureID;
+ cr->colour = colour;
+ cr->two_met = FALSE;
+
+ pthread_attr_init( &cr->stack_att );
+ pthread_attr_setstacksize( &cr->stack_att, STACK_SIZE );
+ pthread_create( &cr->ht, &cr->stack_att, &CreatureThreadRun, (void*)(cr) );
+}
+
+/* format meeting times of each creature to string */
+char* Creature_getResult(struct Creature* cr, char* str)
+{
+ char numstr[256];
+ formatNumber(cr->sameCount, numstr);
+
+ sprintf( str, "%u%s", cr->count, numstr );
+ return str;
+}
+
+
+void runGame( int n_meeting, int ncolor, const enum Colour* colours )
+{
+ int i;
+ int total = 0;
+ char str[256];
+
+ struct MeetingPlace place;
+ struct Creature *creatures = (struct Creature*) calloc( ncolor, sizeof(struct Creature) );
+
+ MeetingPlace_Init( &place, n_meeting );
+
+ /* print initial color of each creature */
+ for (i = 0; i < ncolor; i++)
+ {
+ printf( "%s ", ColourName[ colours[i] ] );
+ Creature_Init( &(creatures[i]), &place, colours[i] );
+ }
+ printf("\n");
+
+ /* wait for them to meet */
+ for (i = 0; i < ncolor; i++)
+ pthread_join( creatures[i].ht, 0 );
+
+ /* print meeting times of each creature */
+ for (i = 0; i < ncolor; i++)
+ {
+ printf( "%s\n", Creature_getResult(&(creatures[i]), str) );
+ total += creatures[i].count;
+ }
+
+ /* print total meeting times, should equal n_meeting */
+ printf( "%s\n\n", formatNumber(total, str) );
+
+ /* cleaup & quit */
+ pthread_mutex_destroy( &place.mutex );
+ free( creatures );
+}
+
+
+void printColours( enum Colour c1, enum Colour c2 )
+{
+ printf( "%s + %s -> %s\n",
+ ColourName[c1],
+ ColourName[c2],
+ ColourName[doCompliment(c1, c2)] );
+}
+
+void printColoursTable(void)
+{
+ printColours(blue, blue);
+ printColours(blue, red);
+ printColours(blue, yellow);
+ printColours(red, blue);
+ printColours(red, red);
+ printColours(red, yellow);
+ printColours(yellow, blue);
+ printColours(yellow, red);
+ printColours(yellow, yellow);
+}
+
+int main(int argc, char** argv)
+{
+ int n = (argc == 2) ? atoi(argv[1]) : 600;
+
+ printColoursTable();
+ printf("\n");
+
+ const enum Colour r1[] = { blue, red, yellow };
+ const enum Colour r2[] = { blue, red, yellow,
+ red, yellow, blue,
+ red, yellow, red, blue };
+
+ runGame( n, sizeof(r1) / sizeof(r1[0]), r1 );
+ runGame( n, sizeof(r2) / sizeof(r2[0]), r2 );
+
+ return 0;
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go
new file mode 100644
index 0000000..3395798
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.go
@@ -0,0 +1,180 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/* The Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ *
+ * contributed by The Go Authors.
+ */
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "strconv"
+)
+
+const (
+ blue = iota
+ red
+ yellow
+ ncol
+)
+
+var complement = [...]int{
+ red | red<<2: red,
+ red | yellow<<2: blue,
+ red | blue<<2: yellow,
+ yellow | red<<2: blue,
+ yellow | yellow<<2: yellow,
+ yellow | blue<<2: red,
+ blue | red<<2: yellow,
+ blue | yellow<<2: red,
+ blue | blue<<2: blue,
+}
+
+var colname = [...]string{
+ blue: "blue",
+ red: "red",
+ yellow: "yellow",
+}
+
+// information about the current state of a creature.
+type info struct {
+ colour int // creature's current colour.
+ name int // creature's name.
+}
+
+// exclusive access data-structure kept inside meetingplace.
+// if mate is nil, it indicates there's no creature currently waiting;
+// otherwise the creature's info is stored in info, and
+// it is waiting to receive its mate's information on the mate channel.
+type rendez struct {
+ n int // current number of encounters.
+ mate chan<- info // creature waiting when non-nil.
+ info info // info about creature waiting.
+}
+
+// result sent by each creature at the end of processing.
+type result struct {
+ met int
+ same int
+}
+
+var n = 600
+
+func main() {
+ flag.Parse()
+ if flag.NArg() > 0 {
+ n, _ = strconv.Atoi(flag.Arg(0))
+ }
+
+ for c0 := 0; c0 < ncol; c0++ {
+ for c1 := 0; c1 < ncol; c1++ {
+ fmt.Printf("%s + %s -> %s\n", colname[c0], colname[c1], colname[complement[c0|c1<<2]])
+ }
+ }
+ fmt.Print("\n")
+
+ pallmall([]int{blue, red, yellow})
+ pallmall([]int{blue, red, yellow, red, yellow, blue, red, yellow, red, blue})
+}
+
+func pallmall(cols []int) {
+
+ // invariant: meetingplace always contains a value unless a creature
+ // is currently dealing with it (whereupon it must put it back).
+ meetingplace := make(chan rendez, 1)
+ meetingplace <- rendez{n: 0}
+
+ ended := make(chan result)
+ msg := ""
+ for i, col := range cols {
+ go creature(info{col, i}, meetingplace, ended)
+ msg += " " + colname[col]
+ }
+ fmt.Println(msg)
+ tot := 0
+ // wait for all results
+ for _ = range cols {
+ result := <-ended
+ tot += result.met
+ fmt.Printf("%v%v\n", result.met, spell(result.same, true))
+ }
+ fmt.Printf("%v\n\n", spell(tot, true))
+}
+
+// in this function, variables ending in 0 refer to the local creature,
+// variables ending in 1 to the creature we've met.
+func creature(info0 info, meetingplace chan rendez, ended chan result) {
+ c0 := make(chan info)
+ met := 0
+ same := 0
+ for {
+ var othername int
+ // get access to rendez data and decide what to do.
+ switch r := <-meetingplace; {
+ case r.n >= n:
+ // if no more meetings left, then send our result data and exit.
+ meetingplace <- rendez{n: r.n}
+ ended <- result{met, same}
+ return
+ case r.mate == nil:
+ // no creature waiting; wait for someone to meet us,
+ // get their info and send our info in reply.
+ meetingplace <- rendez{n: r.n, info: info0, mate: c0}
+ info1 := <-c0
+ othername = info1.name
+ info0.colour = complement[info0.colour|info1.colour<<2]
+ default:
+ // another creature is waiting for us with its info;
+ // increment meeting count,
+ // send them our info in reply.
+ r.n++
+ meetingplace <- rendez{n: r.n, mate: nil}
+ r.mate <- info0
+ othername = r.info.name
+ info0.colour = complement[info0.colour|r.info.colour<<2]
+ }
+ if othername == info0.name {
+ same++
+ }
+ met++
+ }
+}
+
+var digits = [...]string{"zero", "one", "two", "three", "four", "five", "six", "seven", "eight", "nine"}
+
+func spell(n int, required bool) string {
+ if n == 0 && !required {
+ return ""
+ }
+ return spell(n/10, false) + " " + digits[n%10]
+}
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt
new file mode 100644
index 0000000..6016d59
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/chameneosredux.txt
@@ -0,0 +1,29 @@
+blue + blue -> blue
+blue + red -> yellow
+blue + yellow -> red
+red + blue -> yellow
+red + red -> red
+red + yellow -> blue
+yellow + blue -> red
+yellow + red -> blue
+yellow + yellow -> yellow
+
+ blue red yellow
+400 zero
+400 zero
+400 zero
+ one two zero zero
+
+ blue red yellow red yellow blue red yellow red blue
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+120 zero
+ one two zero zero
+
diff --git a/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go
new file mode 100644
index 0000000..7e9b98d
--- /dev/null
+++ b/gcc-4.9/gcc/testsuite/go.test/test/bench/shootout/fannkuch-parallel.go
@@ -0,0 +1,224 @@
+/*
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are met:
+
+ * Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+ * Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+ * Neither the name of "The Computer Language Benchmarks Game" nor the
+ name of "The Computer Language Shootout Benchmarks" nor the names of
+ its contributors may be used to endorse or promote products derived
+ from this software without specific prior written permission.
+
+THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
+AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
+IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
+ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
+LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
+INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
+CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGE.
+*/
+
+/*
+ * The Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ *
+ * contributed by The Go Authors.
+ * Based on fannkuch.scala by Rex Kerr
+ */
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "runtime"
+)
+
+var n = flag.Int("n", 7, "count")
+var nCPU = flag.Int("ncpu", 4, "number of cpus")
+
+type Job struct {
+ start []int
+ n int
+}
+
+type Found struct {
+ who *Kucher
+ k int
+}
+
+type Kucher struct {
+ perm []int
+ temp []int
+ flip []int
+ in chan Job
+}
+
+func NewKucher(length int) *Kucher {
+ return &Kucher{
+ perm: make([]int, length),
+ temp: make([]int, length),
+ flip: make([]int, length),
+ in: make(chan Job),
+ }
+}
+
+func (k *Kucher) permute(n int) bool {
+ i := 0
+ for ; i < n-1 && k.flip[i] == 0; i++ {
+ t := k.perm[0]
+ j := 0
+ for ; j <= i; j++ {
+ k.perm[j] = k.perm[j+1]
+ }
+ k.perm[j] = t
+ }
+ k.flip[i]--
+ for i > 0 {
+ i--
+ k.flip[i] = i
+ }
+ return k.flip[n-1] >= 0
+}
+
+func (k *Kucher) count() int {
+ K := 0
+ copy(k.temp, k.perm)
+ for k.temp[0] != 0 {
+ m := k.temp[0]
+ for i := 0; i < m; i++ {
+ k.temp[i], k.temp[m] = k.temp[m], k.temp[i]
+ m--
+ }
+ K++
+ }
+ return K
+}
+
+func (k *Kucher) Run(foreman chan<- Found) {
+ for job := range k.in {
+ verbose := 30
+ copy(k.perm, job.start)
+ for i, v := range k.perm {
+ if v != i {
+ verbose = 0
+ }
+ k.flip[i] = i
+ }
+ K := 0
+ for {
+ if verbose > 0 {
+ for _, p := range k.perm {
+ fmt.Print(p + 1)
+ }
+ fmt.Println()
+ verbose--
+ }
+ count := k.count()
+ if count > K {
+ K = count
+ }
+ if !k.permute(job.n) {
+ break
+ }
+ }
+ foreman <- Found{k, K}
+ }
+}
+
+type Fanner struct {
+ jobind int
+ jobsdone int
+ k int
+ jobs